Incidental Mutation 'R7722:Atp8a1'
ID595275
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7722 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 67622698 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000142843] [ENSMUST00000200955]
Predicted Effect probably null
Transcript: ENSMUST00000037380
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072971
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135930
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142843
SMART Domains Protein: ENSMUSP00000138599
Gene: ENSMUSG00000050010

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Shisa 23 100 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,808,969 E151G probably benign Het
Alpk2 A T 18: 65,350,157 L260H probably damaging Het
Amh T C 10: 80,806,624 V247A probably benign Het
Ank2 T A 3: 127,029,302 I431L probably benign Het
Ano7 G A 1: 93,390,423 A286T probably damaging Het
Brd1 A T 15: 88,729,559 S378T probably damaging Het
Cd163l1 C A 7: 140,222,386 C209* probably null Het
Clrn1 T A 3: 58,846,334 N202I possibly damaging Het
Cspp1 T C 1: 10,074,901 V308A probably benign Het
Cyp2a5 T C 7: 26,837,118 L174P probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fancm T A 12: 65,106,461 D1230E probably damaging Het
Fbxl17 A T 17: 63,356,828 N555K probably damaging Het
Fmnl2 A C 2: 53,054,467 S153R Het
Fras1 G A 5: 96,769,554 V3478M probably damaging Het
Gnptab T C 10: 88,379,528 F37S probably damaging Het
Gpr183 T G 14: 121,954,858 I84L probably damaging Het
Hcn1 A G 13: 117,902,778 H410R unknown Het
Hmcn1 A G 1: 150,667,880 V2848A probably damaging Het
Hmcn2 A T 2: 31,382,500 R1331* probably null Het
Hsd17b4 A C 18: 50,146,524 N190T probably damaging Het
Kif14 A G 1: 136,468,295 D113G probably benign Het
Kmt2e T G 5: 23,497,018 D881E probably benign Het
Lamb1 T A 12: 31,323,571 L1481Q probably damaging Het
Limk2 T C 11: 3,356,092 probably null Het
Luc7l2 T A 6: 38,603,308 S281T unknown Het
Map3k5 A G 10: 20,132,145 D1240G probably benign Het
Med13l C A 5: 118,747,407 T1475K probably benign Het
Med17 G T 9: 15,271,691 Q353K probably benign Het
Mlh3 A G 12: 85,267,492 V640A probably benign Het
Mms22l T A 4: 24,517,201 Y361N probably damaging Het
Mtmr2 T A 9: 13,804,808 N532K probably benign Het
Mtss1 G A 15: 59,055,086 T47I probably damaging Het
Mturn T C 6: 54,699,560 probably null Het
Muc20 A C 16: 32,797,386 S3A probably benign Het
Nde1 T C 16: 14,190,264 Y164H unknown Het
Neurl1b A G 17: 26,441,158 T451A probably benign Het
Olfr1537 A T 9: 39,237,589 Y278* probably null Het
Olfr654 C A 7: 104,588,298 Q165K possibly damaging Het
Pgap3 G A 11: 98,390,784 A196V probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sdcbp T A 4: 6,385,063 V94E possibly damaging Het
Sgo2a T G 1: 58,016,537 F627V probably benign Het
Skor2 A C 18: 76,862,644 N889T probably benign Het
Slc35f4 A T 14: 49,306,274 N288K probably benign Het
Slc9b2 T A 3: 135,329,835 V355E probably null Het
Smarcc2 A G 10: 128,481,728 E566G possibly damaging Het
Sorcs2 T C 5: 36,043,527 E559G probably damaging Het
Sphkap T C 1: 83,278,921 D369G probably benign Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Stc1 T A 14: 69,032,280 I103N possibly damaging Het
Stx8 T C 11: 68,203,718 V219A probably damaging Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Tshz2 T A 2: 169,885,272 L596Q probably benign Het
Tti1 A G 2: 158,007,607 Y571H probably benign Het
Zbtb40 A G 4: 136,991,518 I956T probably damaging Het
Zfp990 A C 4: 145,536,962 N177H possibly damaging Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACCAGACTGGAATTGGTCAGC -3'
(R):5'- TAGGGGATGTACACTGGCAG -3'

Sequencing Primer
(F):5'- CAGGTTACAGTGATGACCTTAGACTG -3'
(R):5'- TGTACACTGGCAGCCGCTG -3'
Posted On2019-11-12