Incidental Mutation 'R7722:Mtmr2'
ID595283
Institutional Source Beutler Lab
Gene Symbol Mtmr2
Ensembl Gene ENSMUSG00000031918
Gene Namemyotubularin related protein 2
Synonyms6030445P13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R7722 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location13748410-13806481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13804808 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 532 (N532K)
Ref Sequence ENSEMBL: ENSMUSP00000034396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034396] [ENSMUST00000034398] [ENSMUST00000124883] [ENSMUST00000134674] [ENSMUST00000134746] [ENSMUST00000142494] [ENSMUST00000147115] [ENSMUST00000148086] [ENSMUST00000150893] [ENSMUST00000155679]
Predicted Effect probably benign
Transcript: ENSMUST00000034396
AA Change: N532K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034396
Gene: ENSMUSG00000031918
AA Change: N532K

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
GRAM 65 139 1.57e-11 SMART
Pfam:Myotub-related 192 529 1.7e-152 PFAM
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034398
SMART Domains Protein: ENSMUSP00000034398
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 9.8e-67 PFAM
low complexity region 259 271 N/A INTRINSIC
Pfam:Cep57_MT_bd 348 420 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124883
SMART Domains Protein: ENSMUSP00000119081
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 4.7e-34 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134674
SMART Domains Protein: ENSMUSP00000121933
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134746
SMART Domains Protein: ENSMUSP00000116713
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 209 1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142494
SMART Domains Protein: ENSMUSP00000114749
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 3.3e-72 PFAM
low complexity region 259 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147115
SMART Domains Protein: ENSMUSP00000116931
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 2.1e-72 PFAM
low complexity region 254 275 N/A INTRINSIC
Pfam:Cep57_MT_bd 319 394 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148086
SMART Domains Protein: ENSMUSP00000114665
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 41 218 1e-71 PFAM
low complexity region 232 244 N/A INTRINSIC
Pfam:Cep57_MT_bd 318 393 6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150893
SMART Domains Protein: ENSMUSP00000115338
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 5.2e-37 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155679
AA Change: N460K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115906
Gene: ENSMUSG00000031918
AA Change: N460K

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Pfam:Myotub-related 119 459 6.7e-152 PFAM
Pfam:Y_phosphatase 266 370 3.9e-6 PFAM
low complexity region 544 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myotubularin family of phosphoinositide lipid phosphatases. The encoded protein possesses phosphatase activity towards phosphatidylinositol-3-phosphate and phosphatidylinositol-3,5-bisphosphate. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4B, an autosomal recessive demyelinating neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants develop progressive neuropathy characterized by myelin outfolding and recurrent loops and depletion of spermatids and spermatocytes from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,808,969 E151G probably benign Het
Alpk2 A T 18: 65,350,157 L260H probably damaging Het
Amh T C 10: 80,806,624 V247A probably benign Het
Ank2 T A 3: 127,029,302 I431L probably benign Het
Ano7 G A 1: 93,390,423 A286T probably damaging Het
Atp8a1 T A 5: 67,622,698 probably null Het
Brd1 A T 15: 88,729,559 S378T probably damaging Het
Cd163l1 C A 7: 140,222,386 C209* probably null Het
Clrn1 T A 3: 58,846,334 N202I possibly damaging Het
Cspp1 T C 1: 10,074,901 V308A probably benign Het
Cyp2a5 T C 7: 26,837,118 L174P probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fancm T A 12: 65,106,461 D1230E probably damaging Het
Fbxl17 A T 17: 63,356,828 N555K probably damaging Het
Fmnl2 A C 2: 53,054,467 S153R Het
Fras1 G A 5: 96,769,554 V3478M probably damaging Het
Gnptab T C 10: 88,379,528 F37S probably damaging Het
Gpr183 T G 14: 121,954,858 I84L probably damaging Het
Hcn1 A G 13: 117,902,778 H410R unknown Het
Hmcn1 A G 1: 150,667,880 V2848A probably damaging Het
Hmcn2 A T 2: 31,382,500 R1331* probably null Het
Hsd17b4 A C 18: 50,146,524 N190T probably damaging Het
Kif14 A G 1: 136,468,295 D113G probably benign Het
Kmt2e T G 5: 23,497,018 D881E probably benign Het
Lamb1 T A 12: 31,323,571 L1481Q probably damaging Het
Luc7l2 T A 6: 38,603,308 S281T unknown Het
Map3k5 A G 10: 20,132,145 D1240G probably benign Het
Med13l C A 5: 118,747,407 T1475K probably benign Het
Med17 G T 9: 15,271,691 Q353K probably benign Het
Mlh3 A G 12: 85,267,492 V640A probably benign Het
Mms22l T A 4: 24,517,201 Y361N probably damaging Het
Mtss1 G A 15: 59,055,086 T47I probably damaging Het
Muc20 A C 16: 32,797,386 S3A probably benign Het
Nde1 T C 16: 14,190,264 Y164H unknown Het
Neurl1b A G 17: 26,441,158 T451A probably benign Het
Olfr1537 A T 9: 39,237,589 Y278* probably null Het
Olfr654 C A 7: 104,588,298 Q165K possibly damaging Het
Pgap3 G A 11: 98,390,784 A196V probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sdcbp T A 4: 6,385,063 V94E possibly damaging Het
Sgo2a T G 1: 58,016,537 F627V probably benign Het
Skor2 A C 18: 76,862,644 N889T probably benign Het
Slc35f4 A T 14: 49,306,274 N288K probably benign Het
Slc9b2 T A 3: 135,329,835 V355E probably null Het
Smarcc2 A G 10: 128,481,728 E566G possibly damaging Het
Sorcs2 T C 5: 36,043,527 E559G probably damaging Het
Sphkap T C 1: 83,278,921 D369G probably benign Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Stc1 T A 14: 69,032,280 I103N possibly damaging Het
Stx8 T C 11: 68,203,718 V219A probably damaging Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Tshz2 T A 2: 169,885,272 L596Q probably benign Het
Tti1 A G 2: 158,007,607 Y571H probably benign Het
Zbtb40 A G 4: 136,991,518 I956T probably damaging Het
Zfp990 A C 4: 145,536,962 N177H possibly damaging Het
Other mutations in Mtmr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Mtmr2 APN 9 13785916 missense probably benign 0.45
IGL01328:Mtmr2 APN 9 13801927 nonsense probably null
IGL02305:Mtmr2 APN 9 13795255 missense probably damaging 1.00
IGL03069:Mtmr2 APN 9 13793205 nonsense probably null
PIT4431001:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R0280:Mtmr2 UTSW 9 13799249 missense probably damaging 1.00
R0636:Mtmr2 UTSW 9 13801913 critical splice acceptor site probably null
R0831:Mtmr2 UTSW 9 13796113 missense probably damaging 0.99
R1202:Mtmr2 UTSW 9 13803452 missense probably benign
R1663:Mtmr2 UTSW 9 13803501 missense probably damaging 1.00
R1679:Mtmr2 UTSW 9 13789077 missense probably damaging 1.00
R2086:Mtmr2 UTSW 9 13799952 missense probably damaging 1.00
R2254:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2255:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2932:Mtmr2 UTSW 9 13749117 unclassified probably benign
R4172:Mtmr2 UTSW 9 13800062 missense probably damaging 1.00
R4669:Mtmr2 UTSW 9 13795964 missense probably damaging 1.00
R5248:Mtmr2 UTSW 9 13783609 intron probably benign
R5317:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R5326:Mtmr2 UTSW 9 13788647 missense probably damaging 1.00
R5573:Mtmr2 UTSW 9 13793167 missense probably benign 0.15
R5830:Mtmr2 UTSW 9 13801978 missense probably benign 0.00
R6332:Mtmr2 UTSW 9 13800029 missense probably damaging 0.99
R6638:Mtmr2 UTSW 9 13796133 missense probably damaging 1.00
R6791:Mtmr2 UTSW 9 13805382 missense probably benign 0.02
R7072:Mtmr2 UTSW 9 13788620 missense probably benign 0.00
R7474:Mtmr2 UTSW 9 13799225 missense probably damaging 1.00
Z1176:Mtmr2 UTSW 9 13799281 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGATACACGTGTTTGAGAAGAC -3'
(R):5'- TGTGACAAAACTAGTGGGGTC -3'

Sequencing Primer
(F):5'- CTAGAAGAGGGTGCCTTGGAGC -3'
(R):5'- CAGATATGTACCTGAGGTTTCATCCG -3'
Posted On2019-11-12