Incidental Mutation 'R7722:Ehbp1'
ID595290
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene NameEH domain binding protein 1
SynonymsKIAA0903-like, Flj21950
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R7722 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location22005828-22342292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22089572 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 843 (H843Y)
Ref Sequence ENSEMBL: ENSMUSP00000105191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000180360]
Predicted Effect probably null
Transcript: ENSMUST00000045167
AA Change: H818Y

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302
AA Change: H818Y

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109563
AA Change: H843Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: H843Y

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180360
AA Change: H818Y

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302
AA Change: H818Y

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,808,969 E151G probably benign Het
Alpk2 A T 18: 65,350,157 L260H probably damaging Het
Amh T C 10: 80,806,624 V247A probably benign Het
Ank2 T A 3: 127,029,302 I431L probably benign Het
Ano7 G A 1: 93,390,423 A286T probably damaging Het
Atp8a1 T A 5: 67,622,698 probably null Het
Brd1 A T 15: 88,729,559 S378T probably damaging Het
Cd163l1 C A 7: 140,222,386 C209* probably null Het
Clrn1 T A 3: 58,846,334 N202I possibly damaging Het
Cspp1 T C 1: 10,074,901 V308A probably benign Het
Cyp2a5 T C 7: 26,837,118 L174P probably benign Het
Fancm T A 12: 65,106,461 D1230E probably damaging Het
Fbxl17 A T 17: 63,356,828 N555K probably damaging Het
Fmnl2 A C 2: 53,054,467 S153R Het
Fras1 G A 5: 96,769,554 V3478M probably damaging Het
Gnptab T C 10: 88,379,528 F37S probably damaging Het
Gpr183 T G 14: 121,954,858 I84L probably damaging Het
Hcn1 A G 13: 117,902,778 H410R unknown Het
Hmcn1 A G 1: 150,667,880 V2848A probably damaging Het
Hmcn2 A T 2: 31,382,500 R1331* probably null Het
Hsd17b4 A C 18: 50,146,524 N190T probably damaging Het
Kif14 A G 1: 136,468,295 D113G probably benign Het
Kmt2e T G 5: 23,497,018 D881E probably benign Het
Lamb1 T A 12: 31,323,571 L1481Q probably damaging Het
Limk2 T C 11: 3,356,092 probably null Het
Luc7l2 T A 6: 38,603,308 S281T unknown Het
Map3k5 A G 10: 20,132,145 D1240G probably benign Het
Med13l C A 5: 118,747,407 T1475K probably benign Het
Med17 G T 9: 15,271,691 Q353K probably benign Het
Mlh3 A G 12: 85,267,492 V640A probably benign Het
Mms22l T A 4: 24,517,201 Y361N probably damaging Het
Mtmr2 T A 9: 13,804,808 N532K probably benign Het
Mtss1 G A 15: 59,055,086 T47I probably damaging Het
Mturn T C 6: 54,699,560 probably null Het
Muc20 A C 16: 32,797,386 S3A probably benign Het
Nde1 T C 16: 14,190,264 Y164H unknown Het
Neurl1b A G 17: 26,441,158 T451A probably benign Het
Olfr1537 A T 9: 39,237,589 Y278* probably null Het
Olfr654 C A 7: 104,588,298 Q165K possibly damaging Het
Pgap3 G A 11: 98,390,784 A196V probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sdcbp T A 4: 6,385,063 V94E possibly damaging Het
Sgo2a T G 1: 58,016,537 F627V probably benign Het
Skor2 A C 18: 76,862,644 N889T probably benign Het
Slc35f4 A T 14: 49,306,274 N288K probably benign Het
Slc9b2 T A 3: 135,329,835 V355E probably null Het
Smarcc2 A G 10: 128,481,728 E566G possibly damaging Het
Sorcs2 T C 5: 36,043,527 E559G probably damaging Het
Sphkap T C 1: 83,278,921 D369G probably benign Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Stc1 T A 14: 69,032,280 I103N possibly damaging Het
Stx8 T C 11: 68,203,718 V219A probably damaging Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Tshz2 T A 2: 169,885,272 L596Q probably benign Het
Tti1 A G 2: 158,007,607 Y571H probably benign Het
Zbtb40 A G 4: 136,991,518 I956T probably damaging Het
Zfp990 A C 4: 145,536,962 N177H possibly damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22247967 splice site probably benign
IGL00786:Ehbp1 APN 11 22100460 missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22138022 missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22089636 missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22095611 missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22172883 missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22089584 missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22101115 missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22101218 missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22285486 critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22096048 missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22089653 missense probably damaging 1.00
trajan UTSW 11 22151850 missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22089683 splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22053494 missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22231992 splice site probably benign
R0294:Ehbp1 UTSW 11 22095427 missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22095886 missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22151836 missense probably benign
R0468:Ehbp1 UTSW 11 22169184 splice site probably benign
R0943:Ehbp1 UTSW 11 22095883 missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22062831 missense probably benign 0.25
R1481:Ehbp1 UTSW 11 22006782 makesense probably null
R1493:Ehbp1 UTSW 11 22006866 missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22059231 missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22096000 missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22146694 missense probably benign
R1696:Ehbp1 UTSW 11 22053441 missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22151850 missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22059228 missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22095462 missense probably benign
R2436:Ehbp1 UTSW 11 22089524 critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22100465 missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22285498 missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22151843 missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22095892 missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22239169 missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22101073 missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22095370 missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22137846 missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22151887 missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22239156 missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22285684 start gained probably benign
R6685:Ehbp1 UTSW 11 22146641 missense probably benign 0.01
R6893:Ehbp1 UTSW 11 22014945 missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22053529 nonsense probably null
R7465:Ehbp1 UTSW 11 22138001 missense probably benign
R7724:Ehbp1 UTSW 11 22089572 missense probably null
R7797:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22146542 nonsense probably null
R7951:Ehbp1 UTSW 11 22146542 nonsense probably null
RF016:Ehbp1 UTSW 11 22146646 missense probably benign
RF037:Ehbp1 UTSW 11 22006783 small deletion probably benign
X0018:Ehbp1 UTSW 11 22101085 missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22095590 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAATAAGTGATCATGTACCCACA -3'
(R):5'- TGAAGTTTCATCCAGTATTAGGGAA -3'

Sequencing Primer
(F):5'- TGTACCCACAATTTACAGCCTATGG -3'
(R):5'- GTCCTGTTAAAAAGACTGTACACC -3'
Posted On2019-11-12