Incidental Mutation 'R7722:Alpk2'
ID595309
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7722 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65350157 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 260 (L260H)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035548
AA Change: L260H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: L260H

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141250
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,808,969 E151G probably benign Het
Amh T C 10: 80,806,624 V247A probably benign Het
Ank2 T A 3: 127,029,302 I431L probably benign Het
Ano7 G A 1: 93,390,423 A286T probably damaging Het
Atp8a1 T A 5: 67,622,698 probably null Het
Brd1 A T 15: 88,729,559 S378T probably damaging Het
Cd163l1 C A 7: 140,222,386 C209* probably null Het
Clrn1 T A 3: 58,846,334 N202I possibly damaging Het
Cspp1 T C 1: 10,074,901 V308A probably benign Het
Cyp2a5 T C 7: 26,837,118 L174P probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fancm T A 12: 65,106,461 D1230E probably damaging Het
Fbxl17 A T 17: 63,356,828 N555K probably damaging Het
Fmnl2 A C 2: 53,054,467 S153R Het
Fras1 G A 5: 96,769,554 V3478M probably damaging Het
Gnptab T C 10: 88,379,528 F37S probably damaging Het
Gpr183 T G 14: 121,954,858 I84L probably damaging Het
Hcn1 A G 13: 117,902,778 H410R unknown Het
Hmcn1 A G 1: 150,667,880 V2848A probably damaging Het
Hmcn2 A T 2: 31,382,500 R1331* probably null Het
Hsd17b4 A C 18: 50,146,524 N190T probably damaging Het
Kif14 A G 1: 136,468,295 D113G probably benign Het
Kmt2e T G 5: 23,497,018 D881E probably benign Het
Lamb1 T A 12: 31,323,571 L1481Q probably damaging Het
Luc7l2 T A 6: 38,603,308 S281T unknown Het
Map3k5 A G 10: 20,132,145 D1240G probably benign Het
Med13l C A 5: 118,747,407 T1475K probably benign Het
Med17 G T 9: 15,271,691 Q353K probably benign Het
Mlh3 A G 12: 85,267,492 V640A probably benign Het
Mms22l T A 4: 24,517,201 Y361N probably damaging Het
Mtmr2 T A 9: 13,804,808 N532K probably benign Het
Mtss1 G A 15: 59,055,086 T47I probably damaging Het
Muc20 A C 16: 32,797,386 S3A probably benign Het
Nde1 T C 16: 14,190,264 Y164H unknown Het
Neurl1b A G 17: 26,441,158 T451A probably benign Het
Olfr1537 A T 9: 39,237,589 Y278* probably null Het
Olfr654 C A 7: 104,588,298 Q165K possibly damaging Het
Pgap3 G A 11: 98,390,784 A196V probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sdcbp T A 4: 6,385,063 V94E possibly damaging Het
Sgo2a T G 1: 58,016,537 F627V probably benign Het
Skor2 A C 18: 76,862,644 N889T probably benign Het
Slc35f4 A T 14: 49,306,274 N288K probably benign Het
Slc9b2 T A 3: 135,329,835 V355E probably null Het
Smarcc2 A G 10: 128,481,728 E566G possibly damaging Het
Sorcs2 T C 5: 36,043,527 E559G probably damaging Het
Sphkap T C 1: 83,278,921 D369G probably benign Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Stc1 T A 14: 69,032,280 I103N possibly damaging Het
Stx8 T C 11: 68,203,718 V219A probably damaging Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Tshz2 T A 2: 169,885,272 L596Q probably benign Het
Tti1 A G 2: 158,007,607 Y571H probably benign Het
Zbtb40 A G 4: 136,991,518 I956T probably damaging Het
Zfp990 A C 4: 145,536,962 N177H possibly damaging Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCGTCATAACATCGGAACATTC -3'
(R):5'- AGGATGGGGCAGTACAATTC -3'

Sequencing Primer
(F):5'- ATTCCAGATACTCCAGGTCATCATC -3'
(R):5'- GGGCAGTACAATTCAAATAACATGC -3'
Posted On2019-11-12