Incidental Mutation 'R0242:Helz2'
ID 59531
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0242 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 181227615-181242027 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 181230430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 2539 (R2539Q)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: R2583Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: R2583Q

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108831
AA Change: R2583Q

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: R2583Q

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: R2539Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: R2539Q

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Meta Mutation Damage Score 0.2568 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 (GRCm38) D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 (GRCm38) probably benign Het
Abhd13 A G 8: 9,987,561 (GRCm38) I53V probably benign Het
Adgrl2 A C 3: 148,839,185 (GRCm38) probably null Het
Aldh16a1 G A 7: 45,144,664 (GRCm38) A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 (GRCm38) Y262* probably null Het
Ambn A G 5: 88,467,972 (GRCm38) Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 (GRCm38) probably benign Het
Arhgap9 C A 10: 127,329,538 (GRCm38) H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 (GRCm38) G435E probably damaging Het
Armc12 A T 17: 28,532,392 (GRCm38) D120V possibly damaging Het
Armc4 A T 18: 7,211,516 (GRCm38) V786D probably damaging Het
Asxl3 G A 18: 22,516,681 (GRCm38) E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 (GRCm38) E141G probably benign Het
Bmpr1b G A 3: 141,840,676 (GRCm38) T483M probably damaging Het
Caprin2 C T 6: 148,842,954 (GRCm38) S991N probably damaging Het
Cd96 T C 16: 46,071,766 (GRCm38) I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 (GRCm38) F480L probably benign Het
Celf5 T C 10: 81,464,409 (GRCm38) T258A probably benign Het
Cgnl1 A G 9: 71,721,657 (GRCm38) V577A probably damaging Het
Clca3b A G 3: 144,841,465 (GRCm38) S304P probably benign Het
Cmya5 A T 13: 93,095,600 (GRCm38) H993Q probably benign Het
Cnbp A T 6: 87,845,764 (GRCm38) C6S probably damaging Het
Col14a1 C T 15: 55,497,511 (GRCm38) R1605W probably damaging Het
Cops7a T C 6: 124,964,854 (GRCm38) N11S probably benign Het
Coro7 T C 16: 4,630,178 (GRCm38) probably benign Het
Cpvl T C 6: 53,932,500 (GRCm38) H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 (GRCm38) probably benign Het
Cyp2c66 A G 19: 39,141,925 (GRCm38) Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 (GRCm38) T1324M probably benign Het
Dlgap2 A G 8: 14,727,562 (GRCm38) D268G probably benign Het
Dnm1 T A 2: 32,316,989 (GRCm38) M535L possibly damaging Het
Dock7 A T 4: 98,962,280 (GRCm38) F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 (GRCm38) H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 (GRCm38) D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 (GRCm38) E21G probably null Het
Fam120b T A 17: 15,422,924 (GRCm38) V655D probably damaging Het
Fam129a A G 1: 151,718,216 (GRCm38) D884G probably benign Het
Fkbp5 A T 17: 28,428,452 (GRCm38) D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 (GRCm38) Y179* probably null Het
Gfer A G 17: 24,694,303 (GRCm38) W192R probably damaging Het
Gm4782 A G 6: 50,609,858 (GRCm38) T408A probably benign Het
Golgb1 C T 16: 36,875,630 (GRCm38) Q164* probably null Het
Gpnmb A G 6: 49,047,342 (GRCm38) N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 (GRCm38) T414M probably benign Het
Hc A G 2: 35,036,154 (GRCm38) probably benign Het
Hcfc1 A T X: 73,948,429 (GRCm38) probably benign Het
Hsd17b12 T A 2: 94,157,815 (GRCm38) I19F probably benign Het
Incenp T C 19: 9,893,750 (GRCm38) T172A unknown Het
Jmy A G 13: 93,441,618 (GRCm38) Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 (GRCm38) T36A probably benign Het
Kcnh4 T C 11: 100,755,699 (GRCm38) D267G probably damaging Het
Krt34 C T 11: 100,041,331 (GRCm38) E56K probably damaging Het
Krt40 T A 11: 99,538,742 (GRCm38) E335D probably damaging Het
Krt86 T A 15: 101,476,573 (GRCm38) Y282* probably null Het
Lgi3 C T 14: 70,534,815 (GRCm38) R267* probably null Het
Lnpk A G 2: 74,537,289 (GRCm38) probably benign Het
Lrp1b T A 2: 40,998,183 (GRCm38) H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 (GRCm38) R542H probably benign Het
Mia2 T C 12: 59,108,856 (GRCm38) Y452H probably damaging Het
Mmachc C T 4: 116,704,541 (GRCm38) R132Q probably damaging Het
Mtbp T A 15: 55,577,486 (GRCm38) N356K possibly damaging Het
Mum1 T C 10: 80,234,258 (GRCm38) S354P probably benign Het
Myo5b A G 18: 74,661,716 (GRCm38) H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 (GRCm38) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,791,774 (GRCm38) probably benign Het
Olfr398 T C 11: 73,983,712 (GRCm38) S299G probably benign Het
Olfr786 T A 10: 129,437,348 (GRCm38) Y179N probably damaging Het
Otog G T 7: 46,267,381 (GRCm38) C914F probably damaging Het
Pank2 G T 2: 131,280,197 (GRCm38) C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 (GRCm38) S580T probably benign Het
Pdia3 T C 2: 121,414,111 (GRCm38) S2P probably damaging Het
Peli1 G T 11: 21,142,602 (GRCm38) R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 (GRCm38) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm38) D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 (GRCm38) C532R probably damaging Het
Prph A T 15: 99,055,727 (GRCm38) D174V probably damaging Het
Psd3 A G 8: 67,758,086 (GRCm38) M270T probably damaging Het
Pum3 A G 19: 27,422,755 (GRCm38) probably benign Het
Pus1 A T 5: 110,779,798 (GRCm38) H30Q probably benign Het
Rab7 A T 6: 88,005,132 (GRCm38) V87E probably damaging Het
Rbm5 A T 9: 107,751,708 (GRCm38) probably benign Het
Reln A G 5: 21,942,597 (GRCm38) probably null Het
S1pr3 A G 13: 51,418,902 (GRCm38) T40A probably benign Het
Sdk1 T A 5: 142,143,922 (GRCm38) probably benign Het
Senp7 T A 16: 56,179,521 (GRCm38) I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 (GRCm38) probably benign Het
Shroom1 T G 11: 53,465,485 (GRCm38) probably null Het
Slc24a3 T C 2: 145,606,664 (GRCm38) I376T probably benign Het
Slc46a1 T C 11: 78,468,667 (GRCm38) I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 (GRCm38) F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 (GRCm38) I924N probably damaging Het
Slx4 T A 16: 3,986,952 (GRCm38) E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 (GRCm38) probably benign Het
Sorcs1 C T 19: 50,228,221 (GRCm38) G640E probably damaging Het
Sptan1 A T 2: 30,018,401 (GRCm38) M1725L probably benign Het
Sync G A 4: 129,293,721 (GRCm38) R182K probably damaging Het
Syne2 G A 12: 76,098,034 (GRCm38) G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 (GRCm38) T522K probably damaging Het
Tex2 T A 11: 106,519,955 (GRCm38) K414* probably null Het
Thegl G T 5: 77,016,305 (GRCm38) E52* probably null Het
Thsd7a G A 6: 12,503,916 (GRCm38) T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 (GRCm38) A451T possibly damaging Het
Ttn A T 2: 76,826,152 (GRCm38) probably benign Het
Uba2 T C 7: 34,154,629 (GRCm38) I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 (GRCm38) G361* probably null Het
Wbp2nl C T 15: 82,313,787 (GRCm38) A175V probably benign Het
Zc3h12d A G 10: 7,862,566 (GRCm38) E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 (GRCm38) probably benign Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181,229,702 (GRCm38) missense probably damaging 1.00
IGL00515:Helz2 APN 2 181,233,006 (GRCm38) nonsense probably null
IGL00704:Helz2 APN 2 181,234,385 (GRCm38) missense probably damaging 1.00
IGL00847:Helz2 APN 2 181,232,245 (GRCm38) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181,233,977 (GRCm38) missense probably damaging 1.00
IGL01783:Helz2 APN 2 181,232,881 (GRCm38) missense probably damaging 1.00
IGL01790:Helz2 APN 2 181,238,481 (GRCm38) missense probably benign 0.29
IGL02116:Helz2 APN 2 181,232,185 (GRCm38) missense probably damaging 1.00
IGL02226:Helz2 APN 2 181,231,690 (GRCm38) missense probably damaging 1.00
IGL02402:Helz2 APN 2 181,230,911 (GRCm38) missense probably damaging 1.00
IGL02403:Helz2 APN 2 181,231,022 (GRCm38) missense probably damaging 1.00
IGL02733:Helz2 APN 2 181,235,026 (GRCm38) missense probably benign 0.14
IGL02869:Helz2 APN 2 181,231,146 (GRCm38) intron probably benign
IGL03003:Helz2 APN 2 181,240,253 (GRCm38) missense probably damaging 1.00
IGL03060:Helz2 APN 2 181,229,222 (GRCm38) critical splice donor site probably null
IGL03310:Helz2 APN 2 181,231,804 (GRCm38) missense probably benign 0.00
Colby UTSW 2 181,233,202 (GRCm38) missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181,234,834 (GRCm38) missense probably benign 0.03
R0013:Helz2 UTSW 2 181,240,959 (GRCm38) missense probably benign
R0013:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0014:Helz2 UTSW 2 181,240,511 (GRCm38) missense probably damaging 1.00
R0014:Helz2 UTSW 2 181,240,511 (GRCm38) missense probably damaging 1.00
R0016:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0018:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0019:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0019:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0055:Helz2 UTSW 2 181,228,821 (GRCm38) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181,228,821 (GRCm38) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181,236,407 (GRCm38) missense probably damaging 1.00
R0071:Helz2 UTSW 2 181,236,407 (GRCm38) missense probably damaging 1.00
R0111:Helz2 UTSW 2 181,237,802 (GRCm38) missense probably benign 0.30
R0117:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0135:Helz2 UTSW 2 181,232,269 (GRCm38) missense probably damaging 1.00
R0194:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0242:Helz2 UTSW 2 181,230,430 (GRCm38) missense probably damaging 1.00
R0254:Helz2 UTSW 2 181,232,759 (GRCm38) missense probably damaging 1.00
R0410:Helz2 UTSW 2 181,230,593 (GRCm38) missense probably damaging 1.00
R0442:Helz2 UTSW 2 181,232,209 (GRCm38) missense probably damaging 0.97
R0497:Helz2 UTSW 2 181,229,656 (GRCm38) missense probably damaging 0.97
R0517:Helz2 UTSW 2 181,227,770 (GRCm38) missense probably benign 0.00
R0541:Helz2 UTSW 2 181,234,825 (GRCm38) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181,232,089 (GRCm38) missense probably damaging 1.00
R0591:Helz2 UTSW 2 181,232,116 (GRCm38) missense probably damaging 0.96
R0692:Helz2 UTSW 2 181,240,881 (GRCm38) missense probably benign
R0826:Helz2 UTSW 2 181,240,853 (GRCm38) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181,230,777 (GRCm38) missense probably damaging 1.00
R0880:Helz2 UTSW 2 181,236,135 (GRCm38) missense probably benign
R1170:Helz2 UTSW 2 181,229,815 (GRCm38) missense probably damaging 1.00
R1186:Helz2 UTSW 2 181,231,128 (GRCm38) missense probably damaging 1.00
R1344:Helz2 UTSW 2 181,237,596 (GRCm38) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181,232,981 (GRCm38) missense probably damaging 1.00
R1436:Helz2 UTSW 2 181,235,524 (GRCm38) missense probably damaging 0.99
R1464:Helz2 UTSW 2 181,239,654 (GRCm38) missense probably damaging 1.00
R1464:Helz2 UTSW 2 181,239,654 (GRCm38) missense probably damaging 1.00
R1466:Helz2 UTSW 2 181,236,297 (GRCm38) missense probably damaging 1.00
R1466:Helz2 UTSW 2 181,236,297 (GRCm38) missense probably damaging 1.00
R1477:Helz2 UTSW 2 181,232,804 (GRCm38) missense probably benign 0.00
R1564:Helz2 UTSW 2 181,233,228 (GRCm38) missense probably benign 0.01
R1584:Helz2 UTSW 2 181,236,297 (GRCm38) missense probably damaging 1.00
R1655:Helz2 UTSW 2 181,234,147 (GRCm38) missense probably damaging 0.99
R1757:Helz2 UTSW 2 181,236,263 (GRCm38) missense probably damaging 1.00
R1779:Helz2 UTSW 2 181,238,459 (GRCm38) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 181,234,987 (GRCm38) missense probably benign
R1837:Helz2 UTSW 2 181,229,289 (GRCm38) missense probably damaging 1.00
R1845:Helz2 UTSW 2 181,232,085 (GRCm38) missense probably benign 0.02
R1894:Helz2 UTSW 2 181,234,289 (GRCm38) missense probably damaging 1.00
R1913:Helz2 UTSW 2 181,233,750 (GRCm38) missense probably damaging 1.00
R2005:Helz2 UTSW 2 181,231,329 (GRCm38) missense probably benign 0.45
R2034:Helz2 UTSW 2 181,232,578 (GRCm38) missense probably damaging 1.00
R2036:Helz2 UTSW 2 181,237,479 (GRCm38) missense probably benign 0.03
R2061:Helz2 UTSW 2 181,240,544 (GRCm38) missense probably damaging 1.00
R2088:Helz2 UTSW 2 181,235,102 (GRCm38) missense probably benign 0.07
R2142:Helz2 UTSW 2 181,231,380 (GRCm38) missense probably benign
R2180:Helz2 UTSW 2 181,233,732 (GRCm38) missense probably damaging 1.00
R2192:Helz2 UTSW 2 181,229,048 (GRCm38) nonsense probably null
R2248:Helz2 UTSW 2 181,233,433 (GRCm38) missense probably benign 0.33
R2495:Helz2 UTSW 2 181,232,912 (GRCm38) missense probably damaging 0.99
R2886:Helz2 UTSW 2 181,240,742 (GRCm38) missense probably benign
R3617:Helz2 UTSW 2 181,233,061 (GRCm38) missense probably damaging 1.00
R3776:Helz2 UTSW 2 181,240,389 (GRCm38) nonsense probably null
R3803:Helz2 UTSW 2 181,239,996 (GRCm38) missense probably damaging 0.96
R4043:Helz2 UTSW 2 181,229,710 (GRCm38) missense probably benign 0.00
R4052:Helz2 UTSW 2 181,240,475 (GRCm38) missense probably damaging 1.00
R4232:Helz2 UTSW 2 181,229,902 (GRCm38) missense probably damaging 1.00
R4521:Helz2 UTSW 2 181,228,833 (GRCm38) missense probably benign
R4624:Helz2 UTSW 2 181,239,308 (GRCm38) missense probably damaging 0.99
R4720:Helz2 UTSW 2 181,238,417 (GRCm38) missense probably damaging 1.00
R4831:Helz2 UTSW 2 181,237,417 (GRCm38) missense probably damaging 1.00
R4852:Helz2 UTSW 2 181,230,120 (GRCm38) missense probably damaging 1.00
R4894:Helz2 UTSW 2 181,236,147 (GRCm38) missense probably benign 0.01
R4915:Helz2 UTSW 2 181,232,438 (GRCm38) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181,240,916 (GRCm38) missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181,240,569 (GRCm38) missense probably benign
R5089:Helz2 UTSW 2 181,235,149 (GRCm38) missense probably benign 0.14
R5190:Helz2 UTSW 2 181,230,757 (GRCm38) critical splice donor site probably null
R5309:Helz2 UTSW 2 181,234,846 (GRCm38) missense probably benign 0.08
R5358:Helz2 UTSW 2 181,235,528 (GRCm38) missense probably damaging 1.00
R5379:Helz2 UTSW 2 181,235,069 (GRCm38) missense probably benign
R5559:Helz2 UTSW 2 181,230,126 (GRCm38) missense probably damaging 0.98
R5591:Helz2 UTSW 2 181,240,258 (GRCm38) missense probably damaging 0.99
R5596:Helz2 UTSW 2 181,237,289 (GRCm38) intron probably benign
R5805:Helz2 UTSW 2 181,240,508 (GRCm38) missense probably damaging 1.00
R5823:Helz2 UTSW 2 181,236,396 (GRCm38) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181,232,656 (GRCm38) missense probably benign 0.02
R5873:Helz2 UTSW 2 181,234,028 (GRCm38) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181,230,384 (GRCm38) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181,230,767 (GRCm38) missense probably damaging 1.00
R5975:Helz2 UTSW 2 181,231,050 (GRCm38) missense probably benign 0.08
R6045:Helz2 UTSW 2 181,240,313 (GRCm38) missense probably benign 0.03
R6077:Helz2 UTSW 2 181,233,038 (GRCm38) missense probably benign 0.41
R6218:Helz2 UTSW 2 181,232,294 (GRCm38) missense probably benign 0.03
R6218:Helz2 UTSW 2 181,235,945 (GRCm38) missense probably damaging 1.00
R6315:Helz2 UTSW 2 181,233,202 (GRCm38) missense probably damaging 1.00
R6346:Helz2 UTSW 2 181,233,467 (GRCm38) missense probably damaging 1.00
R6371:Helz2 UTSW 2 181,233,467 (GRCm38) missense probably damaging 1.00
R6372:Helz2 UTSW 2 181,233,467 (GRCm38) missense probably damaging 1.00
R6373:Helz2 UTSW 2 181,233,467 (GRCm38) missense probably damaging 1.00
R6385:Helz2 UTSW 2 181,233,467 (GRCm38) missense probably damaging 1.00
R6464:Helz2 UTSW 2 181,235,069 (GRCm38) missense probably benign
R6581:Helz2 UTSW 2 181,229,379 (GRCm38) missense probably damaging 0.99
R6651:Helz2 UTSW 2 181,239,557 (GRCm38) nonsense probably null
R6964:Helz2 UTSW 2 181,230,428 (GRCm38) missense probably damaging 1.00
R7061:Helz2 UTSW 2 181,240,514 (GRCm38) missense probably damaging 1.00
R7153:Helz2 UTSW 2 181,231,285 (GRCm38) missense probably benign 0.00
R7372:Helz2 UTSW 2 181,238,423 (GRCm38) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 181,235,600 (GRCm38) splice site probably null
R7512:Helz2 UTSW 2 181,230,854 (GRCm38) missense probably benign 0.00
R7583:Helz2 UTSW 2 181,237,572 (GRCm38) missense probably benign 0.06
R7724:Helz2 UTSW 2 181,231,996 (GRCm38) missense probably damaging 1.00
R7733:Helz2 UTSW 2 181,230,355 (GRCm38) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 181,234,531 (GRCm38) missense probably damaging 1.00
R7774:Helz2 UTSW 2 181,233,991 (GRCm38) missense probably benign
R7799:Helz2 UTSW 2 181,237,989 (GRCm38) missense probably benign 0.15
R7841:Helz2 UTSW 2 181,232,902 (GRCm38) missense probably damaging 1.00
R7939:Helz2 UTSW 2 181,237,750 (GRCm38) missense probably damaging 0.99
R8026:Helz2 UTSW 2 181,240,205 (GRCm38) missense probably benign 0.34
R8030:Helz2 UTSW 2 181,237,896 (GRCm38) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 181,238,262 (GRCm38) missense probably damaging 0.99
R8237:Helz2 UTSW 2 181,229,331 (GRCm38) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 181,238,102 (GRCm38) missense probably damaging 1.00
R8304:Helz2 UTSW 2 181,230,157 (GRCm38) missense probably benign 0.03
R8486:Helz2 UTSW 2 181,229,331 (GRCm38) missense probably damaging 1.00
R8556:Helz2 UTSW 2 181,229,557 (GRCm38) missense probably damaging 1.00
R8878:Helz2 UTSW 2 181,232,767 (GRCm38) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 181,233,127 (GRCm38) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 181,238,380 (GRCm38) missense
R8953:Helz2 UTSW 2 181,233,091 (GRCm38) missense probably damaging 1.00
R8963:Helz2 UTSW 2 181,229,614 (GRCm38) missense probably damaging 1.00
R8969:Helz2 UTSW 2 181,237,788 (GRCm38) missense probably benign 0.19
R8976:Helz2 UTSW 2 181,234,693 (GRCm38) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 181,228,999 (GRCm38) missense probably damaging 1.00
R9031:Helz2 UTSW 2 181,232,468 (GRCm38) missense possibly damaging 0.78
R9052:Helz2 UTSW 2 181,240,175 (GRCm38) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 181,239,640 (GRCm38) missense probably damaging 1.00
R9145:Helz2 UTSW 2 181,240,055 (GRCm38) missense probably damaging 1.00
R9185:Helz2 UTSW 2 181,230,090 (GRCm38) missense probably benign
R9186:Helz2 UTSW 2 181,234,664 (GRCm38) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 181,240,948 (GRCm38) missense probably benign
R9407:Helz2 UTSW 2 181,240,182 (GRCm38) missense probably benign 0.01
R9465:Helz2 UTSW 2 181,232,917 (GRCm38) missense probably benign 0.01
R9502:Helz2 UTSW 2 181,236,452 (GRCm38) missense possibly damaging 0.47
R9538:Helz2 UTSW 2 181,240,221 (GRCm38) missense probably damaging 1.00
R9554:Helz2 UTSW 2 181,240,677 (GRCm38) missense probably damaging 0.96
R9659:Helz2 UTSW 2 181,240,232 (GRCm38) missense probably benign 0.00
R9800:Helz2 UTSW 2 181,240,823 (GRCm38) missense probably damaging 0.99
X0064:Helz2 UTSW 2 181,231,741 (GRCm38) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 181,237,564 (GRCm38) missense probably benign 0.39
Z1177:Helz2 UTSW 2 181,235,961 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGCTCTTTGATGCCGCAC -3'
(R):5'- CTGTTTGGCAAGACCTCTCAGGAAG -3'

Sequencing Primer
(F):5'- TCTTTGATGCCGCACAGGAG -3'
(R):5'- GACCTCTCAGGAAGGAAGACC -3'
Posted On 2013-07-11