Incidental Mutation 'R7723:Veph1'
ID595322
Institutional Source Beutler Lab
Gene Symbol Veph1
Ensembl Gene ENSMUSG00000027831
Gene Nameventricular zone expressed PH domain-containing 1
SynonymsVeph, 2810471M23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7723 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location66053558-66296837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66205672 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 237 (C237F)
Ref Sequence ENSEMBL: ENSMUSP00000029419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029419
AA Change: C237F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029419
Gene: ENSMUSG00000027831
AA Change: C237F

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Blast:PH 586 626 1e-5 BLAST
PH 717 821 1.44e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip G A 2: 22,871,562 probably null Het
Brinp3 C T 1: 146,701,671 T148I probably damaging Het
C1qa A T 4: 136,896,433 C153* probably null Het
Camkk1 G T 11: 73,037,232 R363L probably benign Het
Cenpu T C 8: 46,576,314 S351P probably damaging Het
Chd9 C T 8: 91,015,209 L1609F unknown Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Cyp3a59 A T 5: 146,079,344 I4F probably benign Het
Dph6 A G 2: 114,644,755 V93A probably damaging Het
Egf T A 3: 129,706,137 M785L probably benign Het
Fbn1 A T 2: 125,382,034 C598* probably null Het
Fer T C 17: 63,896,278 S68P probably damaging Het
Herc1 C T 9: 66,371,876 T22I probably benign Het
Kat2b A G 17: 53,638,387 D278G possibly damaging Het
Kdm1a C T 4: 136,557,749 V520I probably benign Het
Lrrc4c G T 2: 97,630,654 V542L possibly damaging Het
Lrrtm3 T C 10: 64,088,648 T247A possibly damaging Het
Macf1 T C 4: 123,432,924 S4929G probably benign Het
Mbd4 A T 6: 115,845,363 H428Q possibly damaging Het
Mink1 C G 11: 70,612,910 Q1183E probably benign Het
Myo9a C T 9: 59,779,858 P82L probably damaging Het
Nts T C 10: 102,484,923 T102A probably damaging Het
Nup35 T C 2: 80,656,031 I230T possibly damaging Het
Nwd2 A T 5: 63,808,004 T1644S possibly damaging Het
Nynrin T A 14: 55,872,045 N1536K possibly damaging Het
Olfr1174-ps A C 2: 88,311,475 V107G possibly damaging Het
Olfr168 A T 16: 19,530,608 L104* probably null Het
Olfr520 A G 7: 99,735,677 Y178C possibly damaging Het
Olfr62 A G 4: 118,665,717 S67G probably benign Het
Olfr976 A T 9: 39,956,624 Y104N possibly damaging Het
Palld C T 8: 61,711,458 V400I probably damaging Het
Pank2 T C 2: 131,280,338 V261A probably damaging Het
Pcdhb3 C A 18: 37,302,512 N510K probably damaging Het
Pfkfb2 A T 1: 130,707,588 Y79N probably damaging Het
Phc2 C T 4: 128,723,089 A385V probably benign Het
Prob1 T C 18: 35,652,889 T771A possibly damaging Het
Psmb6 T C 11: 70,526,570 V109A possibly damaging Het
Ptcd1 T C 5: 145,154,829 T487A probably damaging Het
Ralgapa1 A T 12: 55,741,513 M595K probably benign Het
Rps12 A T 10: 23,786,854 V14D probably benign Het
Scn3b C A 9: 40,288,397 S203* probably null Het
Serinc1 G A 10: 57,527,822 P15L probably benign Het
Six2 A G 17: 85,687,675 I93T probably benign Het
Slco1a1 T A 6: 141,909,069 I619F probably damaging Het
Snx25 A C 8: 46,038,479 V858G probably damaging Het
Sspo G A 6: 48,464,638 C1903Y probably damaging Het
Tas2r116 T A 6: 132,855,904 I156N probably benign Het
Tasp1 G T 2: 139,985,131 T189K probably damaging Het
Tdrd6 A T 17: 43,625,960 M1399K probably benign Het
Tecta C A 9: 42,366,936 C1092F probably damaging Het
Tmem150a G A 6: 72,359,074 V215I probably damaging Het
Tmem176b C T 6: 48,835,935 V109I probably benign Het
Trav8d-1 T A 14: 52,778,864 I69K probably damaging Het
Ttn A T 2: 76,808,075 L13954I probably damaging Het
Vmn1r121 G A 7: 21,098,194 T107I probably damaging Het
Zdhhc13 G A 7: 48,808,819 M300I probably benign Het
Zfp608 T C 18: 54,897,601 D1089G probably damaging Het
Other mutations in Veph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Veph1 APN 3 66255010 missense probably damaging 1.00
IGL01539:Veph1 APN 3 66158075 missense probably benign 0.00
IGL01746:Veph1 APN 3 66158087 missense probably benign
IGL02055:Veph1 APN 3 66205627 missense possibly damaging 0.94
IGL02504:Veph1 APN 3 66172130 missense probably damaging 1.00
IGL02610:Veph1 APN 3 66172167 missense probably damaging 1.00
IGL02647:Veph1 APN 3 66159448 splice site probably benign
IGL03279:Veph1 APN 3 66255022 missense probably damaging 1.00
R0317:Veph1 UTSW 3 66171975 missense probably benign
R0318:Veph1 UTSW 3 66057259 missense probably damaging 1.00
R0418:Veph1 UTSW 3 66255028 nonsense probably null
R1913:Veph1 UTSW 3 66244555 missense probably damaging 1.00
R2081:Veph1 UTSW 3 66061102 missense probably damaging 1.00
R2116:Veph1 UTSW 3 66057189 missense probably benign 0.06
R3622:Veph1 UTSW 3 66215437 missense probably benign 0.01
R3623:Veph1 UTSW 3 66215437 missense probably benign 0.01
R3624:Veph1 UTSW 3 66215437 missense probably benign 0.01
R3829:Veph1 UTSW 3 66159327 missense possibly damaging 0.92
R3862:Veph1 UTSW 3 66254892 missense probably damaging 1.00
R3974:Veph1 UTSW 3 66158227 missense probably benign
R4209:Veph1 UTSW 3 66244546 missense probably damaging 1.00
R4361:Veph1 UTSW 3 66159316 missense probably benign 0.00
R4416:Veph1 UTSW 3 66061185 missense probably damaging 0.99
R5478:Veph1 UTSW 3 66255022 missense probably damaging 1.00
R6218:Veph1 UTSW 3 66255060 missense probably damaging 1.00
R6399:Veph1 UTSW 3 66125891 missense probably benign 0.03
R6655:Veph1 UTSW 3 66205613 missense possibly damaging 0.50
R6867:Veph1 UTSW 3 66255037 missense probably damaging 1.00
R6877:Veph1 UTSW 3 66255084 missense probably damaging 1.00
R7257:Veph1 UTSW 3 66158282 missense probably benign 0.00
X0025:Veph1 UTSW 3 66244496 missense probably benign
Z1176:Veph1 UTSW 3 66244488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCTTGCCATCTGTCCAG -3'
(R):5'- ACCATGAGTTTAATAACCCCAGG -3'

Sequencing Primer
(F):5'- GCCATCTGTCCAGTGAGGTAG -3'
(R):5'- TCTTAGCACTCAGAAGGCTGG -3'
Posted On2019-11-12