Mutagenetix > Incidental Mutation

Incidental Mutation 'R7723:Palld'

595344

Institutional Source

Beutler Lab

Gene Symbol

Palld

Ensembl Gene

ENSMUSG00000058056

Gene Name

palladin, cytoskeletal associated protein

Synonyms

2410003B16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7723 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61511433-61902690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 61711458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 400 (V400I)

Ref Sequence

ENSEMBL: ENSMUSP00000112442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121493] [ENSMUST00000121785]

AlphaFold

Q9ET54

Predicted Effect

probably damaging
Transcript: ENSMUST00000034057
AA Change: V400I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: V400I

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	667	N/A	INTRINSIC
IGc2	796	865	3.1e-9	SMART
low complexity region	881	906	N/A	INTRINSIC
IGc2	930	998	4.92e-12	SMART
IGc2	1029	1098	1.61e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000121493
AA Change: V11I

SMART Domains

Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: V11I

Domain	Start	End	E-Value	Type
IGc2	71	146	1.6e-11	SMART
low complexity region	250	284	N/A	INTRINSIC
low complexity region	298	326	N/A	INTRINSIC
low complexity region	376	407	N/A	INTRINSIC
low complexity region	416	451	N/A	INTRINSIC
IGc2	632	701	3.1e-9	SMART
low complexity region	717	742	N/A	INTRINSIC
IGc2	766	834	4.92e-12	SMART
IGc2	865	934	1.61e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121785
AA Change: V400I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: V400I

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	673	N/A	INTRINSIC
low complexity region	687	715	N/A	INTRINSIC
low complexity region	765	796	N/A	INTRINSIC
low complexity region	805	840	N/A	INTRINSIC
IGc2	1038	1107	3.1e-9	SMART
low complexity region	1123	1148	N/A	INTRINSIC
IGc2	1172	1240	4.92e-12	SMART
IGc2	1271	1340	1.61e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apbb1ip	G	A	2: 22,871,562		probably null	Het
Brinp3	C	T	1: 146,701,671	T148I	probably damaging	Het
C1qa	A	T	4: 136,896,433	C153*	probably null	Het
Camkk1	G	T	11: 73,037,232	R363L	probably benign	Het
Ccdc80	T	G	16: 45,126,435		probably null	Het
Cenpu	T	C	8: 46,576,314	S351P	probably damaging	Het
Chd9	C	T	8: 91,015,209	L1609F	unknown	Het
Cnr1	T	A	4: 33,944,416	I268N	probably damaging	Het
Cyp3a59	A	T	5: 146,079,344	I4F	probably benign	Het
Dph6	A	G	2: 114,644,755	V93A	probably damaging	Het
Egf	T	A	3: 129,706,137	M785L	probably benign	Het
Fbn1	A	T	2: 125,382,034	C598*	probably null	Het
Fer	T	C	17: 63,896,278	S68P	probably damaging	Het
Herc1	C	T	9: 66,371,876	T22I	probably benign	Het
Kat2b	A	G	17: 53,638,387	D278G	possibly damaging	Het
Kdm1a	C	T	4: 136,557,749	V520I	probably benign	Het
Lrrc4c	G	T	2: 97,630,654	V542L	possibly damaging	Het
Lrrtm3	T	C	10: 64,088,648	T247A	possibly damaging	Het
Macf1	T	C	4: 123,432,924	S4929G	probably benign	Het
Mbd4	A	T	6: 115,845,363	H428Q	possibly damaging	Het
Mink1	C	G	11: 70,612,910	Q1183E	probably benign	Het
Myo9a	C	T	9: 59,779,858	P82L	probably damaging	Het
Nts	T	C	10: 102,484,923	T102A	probably damaging	Het
Nup35	T	C	2: 80,656,031	I230T	possibly damaging	Het
Nwd2	A	T	5: 63,808,004	T1644S	possibly damaging	Het
Nynrin	T	A	14: 55,872,045	N1536K	possibly damaging	Het
Olfr1174-ps	A	C	2: 88,311,475	V107G	possibly damaging	Het
Olfr168	A	T	16: 19,530,608	L104*	probably null	Het
Olfr520	A	G	7: 99,735,677	Y178C	possibly damaging	Het
Olfr62	A	G	4: 118,665,717	S67G	probably benign	Het
Olfr976	A	T	9: 39,956,624	Y104N	possibly damaging	Het
Pank2	T	C	2: 131,280,338	V261A	probably damaging	Het
Pcdhb3	C	A	18: 37,302,512	N510K	probably damaging	Het
Pfkfb2	A	T	1: 130,707,588	Y79N	probably damaging	Het
Phc2	C	T	4: 128,723,089	A385V	probably benign	Het
Prob1	T	C	18: 35,652,889	T771A	possibly damaging	Het
Psmb6	T	C	11: 70,526,570	V109A	possibly damaging	Het
Ptcd1	T	C	5: 145,154,829	T487A	probably damaging	Het
Ralgapa1	A	T	12: 55,741,513	M595K	probably benign	Het
Rps12	A	T	10: 23,786,854	V14D	probably benign	Het
Scn3b	C	A	9: 40,288,397	S203*	probably null	Het
Serinc1	G	A	10: 57,527,822	P15L	probably benign	Het
Six2	A	G	17: 85,687,675	I93T	probably benign	Het
Slco1a1	T	A	6: 141,909,069	I619F	probably damaging	Het
Snx25	A	C	8: 46,038,479	V858G	probably damaging	Het
Sspo	G	A	6: 48,464,638	C1903Y	probably damaging	Het
Tas2r116	T	A	6: 132,855,904	I156N	probably benign	Het
Tasp1	G	T	2: 139,985,131	T189K	probably damaging	Het
Tdrd6	A	T	17: 43,625,960	M1399K	probably benign	Het
Tecta	C	A	9: 42,366,936	C1092F	probably damaging	Het
Tmem150a	G	A	6: 72,359,074	V215I	probably damaging	Het
Tmem176b	C	T	6: 48,835,935	V109I	probably benign	Het
Trav8d-1	T	A	14: 52,778,864	I69K	probably damaging	Het
Ttn	A	T	2: 76,808,075	L13954I	probably damaging	Het
Veph1	C	A	3: 66,205,672	C237F	possibly damaging	Het
Vmn1r121	G	A	7: 21,098,194	T107I	probably damaging	Het
Zdhhc13	G	A	7: 48,808,819	M300I	probably benign	Het
Zfp608	T	C	18: 54,897,601	D1089G	probably damaging	Het

Other mutations in Palld

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Palld	APN	8	61515935	missense	possibly damaging	0.77
IGL01083:Palld	APN	8	61538807	missense	probably benign	0.44
IGL01644:Palld	APN	8	61877478	missense	probably benign	0.28
IGL01672:Palld	APN	8	61877502	missense	probably benign	0.22
IGL01941:Palld	APN	8	61535700	missense	probably benign	0.44
IGL02037:Palld	APN	8	61525114	missense	probably damaging	1.00
IGL02126:Palld	APN	8	61877442	missense	possibly damaging	0.82
IGL02537:Palld	APN	8	61684934	missense	probably benign	0.05
IGL02632:Palld	APN	8	61515245	missense	probably damaging	1.00
IGL02809:Palld	APN	8	61515247	missense	probably damaging	1.00
IGL02901:Palld	APN	8	61876995	nonsense	probably null
IGL03400:Palld	APN	8	61513455	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0745:Palld	UTSW	8	61877703	missense	probably damaging	1.00
R1263:Palld	UTSW	8	61513457	frame shift	probably null
R1342:Palld	UTSW	8	61522882	critical splice donor site	probably null
R1893:Palld	UTSW	8	61516621	missense	probably damaging	1.00
R2017:Palld	UTSW	8	61684765	missense	probably damaging	0.99
R2102:Palld	UTSW	8	61533433	missense	possibly damaging	0.82
R2129:Palld	UTSW	8	61877361	missense	probably benign	0.00
R2246:Palld	UTSW	8	61877135	missense	probably benign	0.01
R3545:Palld	UTSW	8	61550078	missense	possibly damaging	0.95
R3815:Palld	UTSW	8	61549837	intron	probably benign
R3824:Palld	UTSW	8	61709033	missense	probably damaging	1.00
R4412:Palld	UTSW	8	61687372	missense	probably damaging	0.98
R4781:Palld	UTSW	8	61877028	missense	probably benign	0.01
R4836:Palld	UTSW	8	61687381	missense	probably benign	0.11
R4871:Palld	UTSW	8	61549781	intron	probably benign
R4963:Palld	UTSW	8	61703210	missense	probably damaging	1.00
R5036:Palld	UTSW	8	61550162	missense	probably damaging	1.00
R5128:Palld	UTSW	8	61720588	missense	probably damaging	1.00
R5343:Palld	UTSW	8	61549815	intron	probably benign
R5421:Palld	UTSW	8	61516550	missense	probably damaging	1.00
R5427:Palld	UTSW	8	61550072	missense	probably benign	0.01
R5561:Palld	UTSW	8	61516585	missense	probably damaging	1.00
R5651:Palld	UTSW	8	61538788	missense	probably damaging	1.00
R5679:Palld	UTSW	8	61684945	missense	possibly damaging	0.95
R5915:Palld	UTSW	8	61533352	critical splice donor site	probably null
R6153:Palld	UTSW	8	61550152	missense	probably damaging	1.00
R6276:Palld	UTSW	8	61513423	missense	probably damaging	1.00
R6323:Palld	UTSW	8	61720693	missense	probably damaging	1.00
R6659:Palld	UTSW	8	61533443	missense	probably benign	0.28
R7016:Palld	UTSW	8	61515998	missense	probably damaging	1.00
R7124:Palld	UTSW	8	61516645	missense	unknown
R7145:Palld	UTSW	8	61532017	missense	unknown
R7386:Palld	UTSW	8	61532052	missense	unknown
R7407:Palld	UTSW	8	61515941	nonsense	probably null
R8029:Palld	UTSW	8	61877312	missense	probably damaging	1.00
R8402:Palld	UTSW	8	61711406	missense	probably damaging	1.00
R8775:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8775-TAIL:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8887:Palld	UTSW	8	61533478	missense	unknown
R8906:Palld	UTSW	8	61550164	critical splice donor site	probably null
R8969:Palld	UTSW	8	61684849	missense	probably damaging	1.00
R8971:Palld	UTSW	8	61516701	missense	unknown
R8990:Palld	UTSW	8	61515245	missense	probably damaging	1.00
R9012:Palld	UTSW	8	61720663	missense	possibly damaging	0.85
R9145:Palld	UTSW	8	61877073	missense	probably benign	0.01
R9221:Palld	UTSW	8	61516557	missense	unknown
R9228:Palld	UTSW	8	61720537	missense	probably damaging	1.00
R9311:Palld	UTSW	8	61525155	missense	unknown
R9355:Palld	UTSW	8	61516657	missense	unknown
R9376:Palld	UTSW	8	61516657	missense	unknown
R9377:Palld	UTSW	8	61516657	missense	unknown
R9378:Palld	UTSW	8	61516657	missense	unknown
R9467:Palld	UTSW	8	61515230	missense	unknown
R9638:Palld	UTSW	8	61549754	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AATTCCTATTTGAGCTTGGCTG -3'
(R):5'- GACCACACAGCTCTTTTGGC -3'

Sequencing Primer
(F):5'- TTCCTCAGAAAATATTGCATGGG -3'
(R):5'- ACACAGCTCTTTTGGCAGTTTG -3'

Posted On

2019-11-12