Incidental Mutation 'R7723:Tecta'
ID595348
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7723 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42366936 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1092 (C1092F)
Ref Sequence ENSEMBL: ENSMUSP00000040262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: C1092F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: C1092F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: C1092F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: C1092F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip G A 2: 22,871,562 probably null Het
Brinp3 C T 1: 146,701,671 T148I probably damaging Het
C1qa A T 4: 136,896,433 C153* probably null Het
Camkk1 G T 11: 73,037,232 R363L probably benign Het
Ccdc80 T G 16: 45,126,435 probably null Het
Cenpu T C 8: 46,576,314 S351P probably damaging Het
Chd9 C T 8: 91,015,209 L1609F unknown Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Cyp3a59 A T 5: 146,079,344 I4F probably benign Het
Dph6 A G 2: 114,644,755 V93A probably damaging Het
Egf T A 3: 129,706,137 M785L probably benign Het
Fbn1 A T 2: 125,382,034 C598* probably null Het
Fer T C 17: 63,896,278 S68P probably damaging Het
Herc1 C T 9: 66,371,876 T22I probably benign Het
Kat2b A G 17: 53,638,387 D278G possibly damaging Het
Kdm1a C T 4: 136,557,749 V520I probably benign Het
Lrrc4c G T 2: 97,630,654 V542L possibly damaging Het
Lrrtm3 T C 10: 64,088,648 T247A possibly damaging Het
Macf1 T C 4: 123,432,924 S4929G probably benign Het
Mbd4 A T 6: 115,845,363 H428Q possibly damaging Het
Mink1 C G 11: 70,612,910 Q1183E probably benign Het
Myo9a C T 9: 59,779,858 P82L probably damaging Het
Nts T C 10: 102,484,923 T102A probably damaging Het
Nup35 T C 2: 80,656,031 I230T possibly damaging Het
Nwd2 A T 5: 63,808,004 T1644S possibly damaging Het
Nynrin T A 14: 55,872,045 N1536K possibly damaging Het
Olfr1174-ps A C 2: 88,311,475 V107G possibly damaging Het
Olfr168 A T 16: 19,530,608 L104* probably null Het
Olfr520 A G 7: 99,735,677 Y178C possibly damaging Het
Olfr62 A G 4: 118,665,717 S67G probably benign Het
Olfr976 A T 9: 39,956,624 Y104N possibly damaging Het
Palld C T 8: 61,711,458 V400I probably damaging Het
Pank2 T C 2: 131,280,338 V261A probably damaging Het
Pcdhb3 C A 18: 37,302,512 N510K probably damaging Het
Pfkfb2 A T 1: 130,707,588 Y79N probably damaging Het
Phc2 C T 4: 128,723,089 A385V probably benign Het
Prob1 T C 18: 35,652,889 T771A possibly damaging Het
Psmb6 T C 11: 70,526,570 V109A possibly damaging Het
Ptcd1 T C 5: 145,154,829 T487A probably damaging Het
Ralgapa1 A T 12: 55,741,513 M595K probably benign Het
Rps12 A T 10: 23,786,854 V14D probably benign Het
Scn3b C A 9: 40,288,397 S203* probably null Het
Serinc1 G A 10: 57,527,822 P15L probably benign Het
Six2 A G 17: 85,687,675 I93T probably benign Het
Slco1a1 T A 6: 141,909,069 I619F probably damaging Het
Snx25 A C 8: 46,038,479 V858G probably damaging Het
Sspo G A 6: 48,464,638 C1903Y probably damaging Het
Tas2r116 T A 6: 132,855,904 I156N probably benign Het
Tasp1 G T 2: 139,985,131 T189K probably damaging Het
Tdrd6 A T 17: 43,625,960 M1399K probably benign Het
Tmem150a G A 6: 72,359,074 V215I probably damaging Het
Tmem176b C T 6: 48,835,935 V109I probably benign Het
Trav8d-1 T A 14: 52,778,864 I69K probably damaging Het
Ttn A T 2: 76,808,075 L13954I probably damaging Het
Veph1 C A 3: 66,205,672 C237F possibly damaging Het
Vmn1r121 G A 7: 21,098,194 T107I probably damaging Het
Zdhhc13 G A 7: 48,808,819 M300I probably benign Het
Zfp608 T C 18: 54,897,601 D1089G probably damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
R7343:Tecta UTSW 9 42337332 missense probably damaging 1.00
R7355:Tecta UTSW 9 42367142 nonsense probably null
R7635:Tecta UTSW 9 42330987 missense probably benign 0.11
R7653:Tecta UTSW 9 42337236 missense probably damaging 1.00
R8000:Tecta UTSW 9 42367184 nonsense probably null
R8064:Tecta UTSW 9 42394955 missense possibly damaging 0.94
Z1176:Tecta UTSW 9 42392094 missense probably damaging 0.99
Z1177:Tecta UTSW 9 42375576 missense probably benign 0.00
Z1177:Tecta UTSW 9 42392070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAGGCTAGAGATGGGTC -3'
(R):5'- AGTGTGATGAAGGTTATGCCC -3'

Sequencing Primer
(F):5'- TAGAGATGGGTCCCGGTCCTC -3'
(R):5'- GAAGGTTATGCCCTGCAGG -3'
Posted On2019-11-12