Incidental Mutation 'R7723:Rps12'
ID595351
Institutional Source Beutler Lab
Gene Symbol Rps12
Ensembl Gene ENSMUSG00000061983
Gene Nameribosomal protein S12
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7723 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23785183-23787275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23786854 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 14 (V14D)
Ref Sequence ENSEMBL: ENSMUSP00000151305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073926] [ENSMUST00000218107] [ENSMUST00000218221] [ENSMUST00000220070]
Predicted Effect probably benign
Transcript: ENSMUST00000073926
AA Change: V14D

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073581
Gene: ENSMUSG00000061983
AA Change: V14D

DomainStartEndE-ValueType
Pfam:Ribosomal_L7Ae 16 111 2.7e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218107
AA Change: V14D

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000218142
Predicted Effect possibly damaging
Transcript: ENSMUST00000218221
AA Change: V30D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000220070
AA Change: V14D

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S12E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal cancers compared to matched normal colonic mucosa has been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip G A 2: 22,871,562 probably null Het
Brinp3 C T 1: 146,701,671 T148I probably damaging Het
C1qa A T 4: 136,896,433 C153* probably null Het
Camkk1 G T 11: 73,037,232 R363L probably benign Het
Cenpu T C 8: 46,576,314 S351P probably damaging Het
Chd9 C T 8: 91,015,209 L1609F unknown Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Cyp3a59 A T 5: 146,079,344 I4F probably benign Het
Dph6 A G 2: 114,644,755 V93A probably damaging Het
Egf T A 3: 129,706,137 M785L probably benign Het
Fbn1 A T 2: 125,382,034 C598* probably null Het
Fer T C 17: 63,896,278 S68P probably damaging Het
Herc1 C T 9: 66,371,876 T22I probably benign Het
Kat2b A G 17: 53,638,387 D278G possibly damaging Het
Kdm1a C T 4: 136,557,749 V520I probably benign Het
Lrrc4c G T 2: 97,630,654 V542L possibly damaging Het
Lrrtm3 T C 10: 64,088,648 T247A possibly damaging Het
Macf1 T C 4: 123,432,924 S4929G probably benign Het
Mbd4 A T 6: 115,845,363 H428Q possibly damaging Het
Mink1 C G 11: 70,612,910 Q1183E probably benign Het
Myo9a C T 9: 59,779,858 P82L probably damaging Het
Nts T C 10: 102,484,923 T102A probably damaging Het
Nup35 T C 2: 80,656,031 I230T possibly damaging Het
Nwd2 A T 5: 63,808,004 T1644S possibly damaging Het
Nynrin T A 14: 55,872,045 N1536K possibly damaging Het
Olfr1174-ps A C 2: 88,311,475 V107G possibly damaging Het
Olfr168 A T 16: 19,530,608 L104* probably null Het
Olfr520 A G 7: 99,735,677 Y178C possibly damaging Het
Olfr62 A G 4: 118,665,717 S67G probably benign Het
Olfr976 A T 9: 39,956,624 Y104N possibly damaging Het
Palld C T 8: 61,711,458 V400I probably damaging Het
Pank2 T C 2: 131,280,338 V261A probably damaging Het
Pcdhb3 C A 18: 37,302,512 N510K probably damaging Het
Pfkfb2 A T 1: 130,707,588 Y79N probably damaging Het
Phc2 C T 4: 128,723,089 A385V probably benign Het
Prob1 T C 18: 35,652,889 T771A possibly damaging Het
Psmb6 T C 11: 70,526,570 V109A possibly damaging Het
Ptcd1 T C 5: 145,154,829 T487A probably damaging Het
Ralgapa1 A T 12: 55,741,513 M595K probably benign Het
Scn3b C A 9: 40,288,397 S203* probably null Het
Serinc1 G A 10: 57,527,822 P15L probably benign Het
Six2 A G 17: 85,687,675 I93T probably benign Het
Slco1a1 T A 6: 141,909,069 I619F probably damaging Het
Snx25 A C 8: 46,038,479 V858G probably damaging Het
Sspo G A 6: 48,464,638 C1903Y probably damaging Het
Tas2r116 T A 6: 132,855,904 I156N probably benign Het
Tasp1 G T 2: 139,985,131 T189K probably damaging Het
Tdrd6 A T 17: 43,625,960 M1399K probably benign Het
Tecta C A 9: 42,366,936 C1092F probably damaging Het
Tmem150a G A 6: 72,359,074 V215I probably damaging Het
Tmem176b C T 6: 48,835,935 V109I probably benign Het
Trav8d-1 T A 14: 52,778,864 I69K probably damaging Het
Ttn A T 2: 76,808,075 L13954I probably damaging Het
Veph1 C A 3: 66,205,672 C237F possibly damaging Het
Vmn1r121 G A 7: 21,098,194 T107I probably damaging Het
Zdhhc13 G A 7: 48,808,819 M300I probably benign Het
Zfp608 T C 18: 54,897,601 D1089G probably damaging Het
Other mutations in Rps12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Rps12 UTSW 10 23786791 missense probably benign 0.09
R1836:Rps12 UTSW 10 23785629 missense probably damaging 1.00
R2127:Rps12 UTSW 10 23786878 missense possibly damaging 0.75
R4782:Rps12 UTSW 10 23786790 missense possibly damaging 0.62
R7201:Rps12 UTSW 10 23785231 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCGGATGACATTCAGAAC -3'
(R):5'- CAGTGCGTTCAAGATTCGG -3'

Sequencing Primer
(F):5'- GCCGGATGACATTCAGAACTTTTG -3'
(R):5'- GTTCAAGATTCGGCGTCAC -3'
Posted On2019-11-12