Incidental Mutation 'R7723:Prob1'
ID595366
Institutional Source Beutler Lab
Gene Symbol Prob1
Ensembl Gene ENSMUSG00000073600
Gene Nameproline rich basic protein 1
SynonymsLOC381148, Gm1614
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R7723 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location35650351-35655238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35652889 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 771 (T771A)
Ref Sequence ENSEMBL: ENSMUSP00000140465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025209] [ENSMUST00000025211] [ENSMUST00000097619] [ENSMUST00000190196]
Predicted Effect probably benign
Transcript: ENSMUST00000025209
SMART Domains Protein: ENSMUSP00000025209
Gene: ENSMUSG00000024352

DomainStartEndE-ValueType
Pfam:SPATA24 10 191 1.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025211
SMART Domains Protein: ENSMUSP00000025211
Gene: ENSMUSG00000024353

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 48 177 5.8e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097619
AA Change: T767A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095224
Gene: ENSMUSG00000073600
AA Change: T767A

DomainStartEndE-ValueType
low complexity region 78 102 N/A INTRINSIC
low complexity region 142 155 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 536 553 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
Pfam:DUF4585 862 931 4.6e-27 PFAM
low complexity region 989 1002 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190196
AA Change: T771A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140465
Gene: ENSMUSG00000073600
AA Change: T771A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
low complexity region 381 400 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 833 852 N/A INTRINSIC
Pfam:DUF4585 864 936 7.5e-27 PFAM
low complexity region 993 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip G A 2: 22,871,562 probably null Het
Brinp3 C T 1: 146,701,671 T148I probably damaging Het
C1qa A T 4: 136,896,433 C153* probably null Het
Camkk1 G T 11: 73,037,232 R363L probably benign Het
Cenpu T C 8: 46,576,314 S351P probably damaging Het
Chd9 C T 8: 91,015,209 L1609F unknown Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Cyp3a59 A T 5: 146,079,344 I4F probably benign Het
Dph6 A G 2: 114,644,755 V93A probably damaging Het
Egf T A 3: 129,706,137 M785L probably benign Het
Fbn1 A T 2: 125,382,034 C598* probably null Het
Fer T C 17: 63,896,278 S68P probably damaging Het
Herc1 C T 9: 66,371,876 T22I probably benign Het
Kat2b A G 17: 53,638,387 D278G possibly damaging Het
Kdm1a C T 4: 136,557,749 V520I probably benign Het
Lrrc4c G T 2: 97,630,654 V542L possibly damaging Het
Lrrtm3 T C 10: 64,088,648 T247A possibly damaging Het
Macf1 T C 4: 123,432,924 S4929G probably benign Het
Mbd4 A T 6: 115,845,363 H428Q possibly damaging Het
Mink1 C G 11: 70,612,910 Q1183E probably benign Het
Myo9a C T 9: 59,779,858 P82L probably damaging Het
Nts T C 10: 102,484,923 T102A probably damaging Het
Nup35 T C 2: 80,656,031 I230T possibly damaging Het
Nwd2 A T 5: 63,808,004 T1644S possibly damaging Het
Nynrin T A 14: 55,872,045 N1536K possibly damaging Het
Olfr1174-ps A C 2: 88,311,475 V107G possibly damaging Het
Olfr168 A T 16: 19,530,608 L104* probably null Het
Olfr520 A G 7: 99,735,677 Y178C possibly damaging Het
Olfr62 A G 4: 118,665,717 S67G probably benign Het
Olfr976 A T 9: 39,956,624 Y104N possibly damaging Het
Palld C T 8: 61,711,458 V400I probably damaging Het
Pank2 T C 2: 131,280,338 V261A probably damaging Het
Pcdhb3 C A 18: 37,302,512 N510K probably damaging Het
Pfkfb2 A T 1: 130,707,588 Y79N probably damaging Het
Phc2 C T 4: 128,723,089 A385V probably benign Het
Psmb6 T C 11: 70,526,570 V109A possibly damaging Het
Ptcd1 T C 5: 145,154,829 T487A probably damaging Het
Ralgapa1 A T 12: 55,741,513 M595K probably benign Het
Rps12 A T 10: 23,786,854 V14D probably benign Het
Scn3b C A 9: 40,288,397 S203* probably null Het
Serinc1 G A 10: 57,527,822 P15L probably benign Het
Six2 A G 17: 85,687,675 I93T probably benign Het
Slco1a1 T A 6: 141,909,069 I619F probably damaging Het
Snx25 A C 8: 46,038,479 V858G probably damaging Het
Sspo G A 6: 48,464,638 C1903Y probably damaging Het
Tas2r116 T A 6: 132,855,904 I156N probably benign Het
Tasp1 G T 2: 139,985,131 T189K probably damaging Het
Tdrd6 A T 17: 43,625,960 M1399K probably benign Het
Tecta C A 9: 42,366,936 C1092F probably damaging Het
Tmem150a G A 6: 72,359,074 V215I probably damaging Het
Tmem176b C T 6: 48,835,935 V109I probably benign Het
Trav8d-1 T A 14: 52,778,864 I69K probably damaging Het
Ttn A T 2: 76,808,075 L13954I probably damaging Het
Veph1 C A 3: 66,205,672 C237F possibly damaging Het
Vmn1r121 G A 7: 21,098,194 T107I probably damaging Het
Zdhhc13 G A 7: 48,808,819 M300I probably benign Het
Zfp608 T C 18: 54,897,601 D1089G probably damaging Het
Other mutations in Prob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Prob1 APN 18 35653333 missense possibly damaging 0.91
IGL02352:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02359:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02823:Prob1 APN 18 35652747 missense possibly damaging 0.86
IGL03003:Prob1 APN 18 35653375 missense possibly damaging 0.73
IGL03390:Prob1 APN 18 35654139 missense probably benign 0.03
R0257:Prob1 UTSW 18 35653039 missense possibly damaging 0.53
R0421:Prob1 UTSW 18 35653030 missense possibly damaging 0.70
R0457:Prob1 UTSW 18 35652486 missense probably damaging 0.98
R0485:Prob1 UTSW 18 35653825 missense possibly damaging 0.53
R0575:Prob1 UTSW 18 35654721 missense possibly damaging 0.85
R1056:Prob1 UTSW 18 35653610 missense probably benign
R1147:Prob1 UTSW 18 35654806 nonsense probably null
R1334:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1727:Prob1 UTSW 18 35654311 missense possibly damaging 0.73
R1753:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1826:Prob1 UTSW 18 35653575 missense possibly damaging 0.72
R1895:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R1937:Prob1 UTSW 18 35654226 missense possibly damaging 0.53
R2170:Prob1 UTSW 18 35654737 missense probably benign 0.18
R3435:Prob1 UTSW 18 35654241 missense possibly damaging 0.72
R4749:Prob1 UTSW 18 35652816 missense possibly damaging 0.91
R4968:Prob1 UTSW 18 35652552 missense probably damaging 0.98
R5107:Prob1 UTSW 18 35652936 missense possibly damaging 0.53
R5602:Prob1 UTSW 18 35654026 missense possibly damaging 0.96
R5646:Prob1 UTSW 18 35654114 missense probably benign 0.18
R6035:Prob1 UTSW 18 35654782 missense probably benign 0.18
R6747:Prob1 UTSW 18 35655154 missense probably damaging 0.97
R6954:Prob1 UTSW 18 35654268 missense probably benign
R7061:Prob1 UTSW 18 35654500 missense probably benign 0.18
R7292:Prob1 UTSW 18 35654550 missense possibly damaging 0.93
R7296:Prob1 UTSW 18 35653299 missense possibly damaging 0.53
R7566:Prob1 UTSW 18 35654985 missense probably benign 0.33
R7787:Prob1 UTSW 18 35652232 missense possibly damaging 0.73
R7798:Prob1 UTSW 18 35653344 missense possibly damaging 0.93
R8048:Prob1 UTSW 18 35653551 missense probably benign 0.00
X0067:Prob1 UTSW 18 35653091 missense possibly damaging 0.70
Z1088:Prob1 UTSW 18 35652769 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCCTCCACAAAGTAGTACCG -3'
(R):5'- TCCATGCAACCCCTAAGGATG -3'

Sequencing Primer
(F):5'- AAAGTAGTACCGGCCGCTCTC -3'
(R):5'- TAAGGATGCCTCCCAGTCCAG -3'
Posted On2019-11-12