Incidental Mutation 'R0242:Ankib1'
ID 59539
Institutional Source Beutler Lab
Gene Symbol Ankib1
Ensembl Gene ENSMUSG00000040351
Gene Name ankyrin repeat and IBR domain containing 1
Synonyms 2310061P20Rik, 4631416I11Rik
MMRRC Submission 038480-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0242 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 3690000-3802925 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 3700344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]
AlphaFold Q6ZPS6
Predicted Effect probably benign
Transcript: ENSMUST00000043551
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200052
Predicted Effect probably benign
Transcript: ENSMUST00000200335
SMART Domains Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351

DomainStartEndE-ValueType
ANK 45 75 4.5e-3 SMART
ANK 145 174 1.4e-7 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 4.6e-4 SMART
IBR 403 479 2.9e-14 SMART
IBR 502 566 8.3e-8 SMART
RING 520 644 1.1e-2 SMART
low complexity region 768 779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 F480L probably benign Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 T1324M probably benign Het
Dlgap2 A G 8: 14,727,562 D268G probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hc A G 2: 35,036,154 probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Myo5b A G 18: 74,661,716 H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thegl G T 5: 77,016,305 E52* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 A451T possibly damaging Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Ankib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Ankib1 APN 5 3727573 missense probably benign 0.20
IGL01329:Ankib1 APN 5 3734194 splice site probably benign
IGL01372:Ankib1 APN 5 3772594 missense probably damaging 1.00
IGL01593:Ankib1 APN 5 3732590 missense probably benign 0.00
IGL01613:Ankib1 APN 5 3713146 nonsense probably null
IGL01728:Ankib1 APN 5 3701992 splice site probably benign
IGL01782:Ankib1 APN 5 3727607 missense probably damaging 1.00
IGL01878:Ankib1 APN 5 3734152 missense possibly damaging 0.69
IGL02730:Ankib1 APN 5 3702995 missense probably damaging 1.00
IGL02742:Ankib1 APN 5 3693479 missense probably benign 0.04
IGL02873:Ankib1 APN 5 3772619 missense probably damaging 1.00
R0033:Ankib1 UTSW 5 3769588 missense possibly damaging 0.52
R0564:Ankib1 UTSW 5 3729655 missense probably damaging 0.99
R0632:Ankib1 UTSW 5 3772529 missense probably benign 0.02
R0732:Ankib1 UTSW 5 3713163 missense possibly damaging 0.89
R1678:Ankib1 UTSW 5 3706301 missense probably damaging 0.99
R1816:Ankib1 UTSW 5 3734028 missense probably benign 0.05
R2165:Ankib1 UTSW 5 3713210 missense possibly damaging 0.69
R3434:Ankib1 UTSW 5 3692760 missense probably damaging 1.00
R3749:Ankib1 UTSW 5 3734097 missense probably damaging 0.98
R4745:Ankib1 UTSW 5 3732566 missense probably damaging 1.00
R4827:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R4983:Ankib1 UTSW 5 3769652 missense probably benign 0.09
R4989:Ankib1 UTSW 5 3713217 missense probably damaging 0.99
R5022:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5057:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5510:Ankib1 UTSW 5 3729693 missense probably benign 0.02
R5606:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R5910:Ankib1 UTSW 5 3693217 missense probably benign
R5929:Ankib1 UTSW 5 3769633 missense possibly damaging 0.86
R5986:Ankib1 UTSW 5 3747071 missense probably damaging 1.00
R6281:Ankib1 UTSW 5 3701965 missense possibly damaging 0.70
R6336:Ankib1 UTSW 5 3700377 nonsense probably null
R6377:Ankib1 UTSW 5 3693855 missense possibly damaging 0.78
R7001:Ankib1 UTSW 5 3694781 missense probably benign
R7264:Ankib1 UTSW 5 3755739 missense probably damaging 1.00
R7380:Ankib1 UTSW 5 3722576 missense probably benign 0.03
R7402:Ankib1 UTSW 5 3769586 missense probably benign 0.01
R7491:Ankib1 UTSW 5 3701911 missense probably damaging 1.00
R7525:Ankib1 UTSW 5 3755734 missense possibly damaging 0.95
R7562:Ankib1 UTSW 5 3747021 missense probably null 1.00
R8116:Ankib1 UTSW 5 3702995 missense probably damaging 1.00
R8347:Ankib1 UTSW 5 3747065 missense probably damaging 1.00
R8712:Ankib1 UTSW 5 3772643 missense probably benign 0.03
R8750:Ankib1 UTSW 5 3702890 critical splice donor site probably null
R8854:Ankib1 UTSW 5 3727489 missense probably null 0.97
R9032:Ankib1 UTSW 5 3769641 missense probably benign 0.16
R9180:Ankib1 UTSW 5 3706276 missense probably damaging 1.00
R9325:Ankib1 UTSW 5 3772523 missense possibly damaging 0.81
R9474:Ankib1 UTSW 5 3755617 missense probably damaging 0.98
R9504:Ankib1 UTSW 5 3713235 missense probably benign
R9564:Ankib1 UTSW 5 3755733 missense possibly damaging 0.87
Z1088:Ankib1 UTSW 5 3713136 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713137 nonsense probably null
Z1176:Ankib1 UTSW 5 3692763 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCAGTAACCTCAAGAAACTCTTCAC -3'
(R):5'- AAAGGTACTATCCCAAGGGTAAGGGTC -3'

Sequencing Primer
(F):5'- CCTGCTGTAAATCTGACTAAGC -3'
(R):5'- CCAAGGGTAAGGGTCTGGTTG -3'
Posted On 2013-07-11