Incidental Mutation 'R7724:Mical2'
ID595396
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms5330438E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R7724 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location112225856-112355194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112323626 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 613 (Y613N)
Ref Sequence ENSEMBL: ENSMUSP00000047639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
Predicted Effect probably damaging
Transcript: ENSMUST00000037991
AA Change: Y613N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: Y613N

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050149
AA Change: Y613N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: Y613N

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,250 N148D possibly damaging Het
9130401M01Rik A C 15: 58,022,461 S342A probably benign Het
Adarb2 C A 13: 8,570,256 H259Q probably benign Het
Ak7 T A 12: 105,716,030 I150N probably damaging Het
Arhgef12 A T 9: 43,027,271 I75N probably damaging Het
Arhgef17 C T 7: 100,880,609 G480S probably damaging Het
Atic T C 1: 71,564,901 Y208H probably damaging Het
Atp8b4 T A 2: 126,322,893 N1168Y possibly damaging Het
Cdh15 G T 8: 122,866,961 D765Y probably damaging Het
Celf4 C T 18: 25,486,793 probably null Het
Cep57l1 G A 10: 41,745,842 T26M possibly damaging Het
Ces2g T A 8: 104,966,852 D388E probably benign Het
Cir1 T C 2: 73,306,890 N69S possibly damaging Het
Ctc1 C A 11: 69,026,344 H355N probably benign Het
Ebf2 A T 14: 67,424,040 K539M probably damaging Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fat2 C T 11: 55,284,796 G1697E probably damaging Het
Fga A G 3: 83,029,125 D76G probably damaging Het
Fn1 A T 1: 71,603,735 S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 E18D probably damaging Het
Gbp8 A T 5: 105,031,294 I113N probably damaging Het
Gm10549 A T 18: 33,470,859 R132* probably null Het
Gmps T A 3: 63,985,653 D126E possibly damaging Het
Gria4 A G 9: 4,472,074 Y472H probably damaging Het
Helz2 T C 2: 181,231,996 Y2235C probably damaging Het
Hrnr A G 3: 93,323,016 N187S unknown Het
Ifit1bl1 T C 19: 34,594,005 K351E probably benign Het
Klhl23 A G 2: 69,824,712 T309A probably benign Het
Ldhal6b A G 17: 5,418,602 V19A probably benign Het
Lrrc59 C T 11: 94,643,344 R243C probably damaging Het
Magi3 A C 3: 104,015,927 I1158R probably benign Het
Myoc T A 1: 162,639,827 probably null Het
Npas3 C A 12: 54,068,341 S682Y possibly damaging Het
Ogdh T C 11: 6,324,887 V172A probably benign Het
Olfr1076 A G 2: 86,508,605 T49A probably damaging Het
Olfr284 A T 15: 98,340,894 S32T possibly damaging Het
Olfr325 T A 11: 58,581,382 H179Q probably benign Het
Olfr584 T A 7: 103,086,263 C243* probably null Het
Olfr682-ps1 A G 7: 105,128,252 Y52H probably damaging Het
P2rx7 A T 5: 122,673,373 I331F probably benign Het
Pcdhb14 A T 18: 37,448,884 T348S possibly damaging Het
Prdx6b A G 2: 80,293,402 E185G probably benign Het
Rdh1 A G 10: 127,764,707 K200E possibly damaging Het
Sema6c A T 3: 95,173,199 R935W probably damaging Het
Serpinb5 A T 1: 106,875,142 I136F probably damaging Het
Skint10 A T 4: 112,765,092 Y31* probably null Het
St6galnac1 C T 11: 116,766,072 probably null Het
Synj1 G A 16: 90,961,499 T819M probably damaging Het
Tacr3 T A 3: 134,929,908 V291E probably damaging Het
Tdo2 A G 3: 81,968,083 probably null Het
Tex15 T A 8: 33,546,263 D72E possibly damaging Het
Tph2 T C 10: 115,079,822 T438A probably benign Het
Uaca A G 9: 60,869,905 T525A probably benign Het
Ulk1 A T 5: 110,792,404 C384S probably benign Het
Uvrag T C 7: 98,991,963 D290G probably benign Het
Zfp541 T C 7: 16,071,994 L18P probably damaging Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Mical2 APN 7 112315072 missense probably benign 0.00
IGL00934:Mical2 APN 7 112349403 missense probably damaging 1.00
IGL00941:Mical2 APN 7 112321445 splice site probably benign
IGL01020:Mical2 APN 7 112315076 splice site probably benign
IGL01395:Mical2 APN 7 112323585 missense probably damaging 1.00
IGL01658:Mical2 APN 7 112314998 missense probably damaging 1.00
IGL02040:Mical2 APN 7 112311406 missense probably damaging 1.00
IGL02388:Mical2 APN 7 112335413 missense probably benign
IGL02551:Mical2 APN 7 112323990 missense probably benign 0.01
IGL02578:Mical2 APN 7 112351373 missense probably benign 0.05
IGL02751:Mical2 APN 7 112332036 missense probably benign 0.11
R0101:Mical2 UTSW 7 112336867 missense possibly damaging 0.86
R0504:Mical2 UTSW 7 112271317 missense probably benign 0.00
R0594:Mical2 UTSW 7 112318450 missense probably damaging 0.97
R0609:Mical2 UTSW 7 112321440 splice site probably null
R1542:Mical2 UTSW 7 112309468 missense probably damaging 1.00
R1740:Mical2 UTSW 7 112333836 missense probably benign
R1855:Mical2 UTSW 7 112345282 missense probably benign 0.21
R2086:Mical2 UTSW 7 112318603 missense probably benign 0.31
R2136:Mical2 UTSW 7 112271515 missense possibly damaging 0.72
R2418:Mical2 UTSW 7 112320734 critical splice donor site probably null
R3053:Mical2 UTSW 7 112311423 missense probably damaging 1.00
R4308:Mical2 UTSW 7 112331992 missense probably benign 0.27
R4663:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R4868:Mical2 UTSW 7 112318624 missense probably damaging 1.00
R4902:Mical2 UTSW 7 112336900 missense probably benign
R5112:Mical2 UTSW 7 112320611 missense probably damaging 1.00
R5487:Mical2 UTSW 7 112320635 missense probably damaging 1.00
R5563:Mical2 UTSW 7 112314978 missense probably damaging 1.00
R5817:Mical2 UTSW 7 112323659 missense probably benign
R5987:Mical2 UTSW 7 112334948 missense probably benign 0.00
R6087:Mical2 UTSW 7 112318485 nonsense probably null
R6209:Mical2 UTSW 7 112324086 splice site probably null
R6311:Mical2 UTSW 7 112323558 missense probably damaging 1.00
R6319:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R6578:Mical2 UTSW 7 112311445 missense probably damaging 1.00
R6782:Mical2 UTSW 7 112346761 missense probably damaging 1.00
R7061:Mical2 UTSW 7 112346801 missense probably benign 0.10
R7147:Mical2 UTSW 7 112323603 missense possibly damaging 0.77
R7260:Mical2 UTSW 7 112319794 missense probably benign 0.10
R7266:Mical2 UTSW 7 112303756 missense probably damaging 1.00
R7391:Mical2 UTSW 7 112320609 missense probably damaging 1.00
R7747:Mical2 UTSW 7 112333839 missense probably benign 0.02
R7818:Mical2 UTSW 7 112345307 missense probably damaging 1.00
R8022:Mical2 UTSW 7 112303767 missense probably damaging 1.00
R8429:Mical2 UTSW 7 112345253 missense probably benign 0.01
R8505:Mical2 UTSW 7 112319800 missense probably benign 0.02
R8532:Mical2 UTSW 7 112318544 missense probably damaging 1.00
R8862:Mical2 UTSW 7 112311367 missense probably damaging 1.00
RF008:Mical2 UTSW 7 112323626 missense probably damaging 1.00
X0062:Mical2 UTSW 7 112346843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCATCGTCCCACAGTGC -3'
(R):5'- AGAGGTTACCCTTGTTTGGCC -3'

Sequencing Primer
(F):5'- ACAGTGCTTCTTATGCGCAAG -3'
(R):5'- CCTCTGAGTCAAATGGAAGTTGTC -3'
Posted On2019-11-12