Incidental Mutation 'R7724:Cdh15'
ID595399
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Namecadherin 15
SynonymsM cadherin, Mcad, Cdh14
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7724 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122847966-122867397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122866961 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 765 (D765Y)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: D765Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: D765Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,250 N148D possibly damaging Het
9130401M01Rik A C 15: 58,022,461 S342A probably benign Het
Adarb2 C A 13: 8,570,256 H259Q probably benign Het
Ak7 T A 12: 105,716,030 I150N probably damaging Het
Arhgef12 A T 9: 43,027,271 I75N probably damaging Het
Arhgef17 C T 7: 100,880,609 G480S probably damaging Het
Atic T C 1: 71,564,901 Y208H probably damaging Het
Atp8b4 T A 2: 126,322,893 N1168Y possibly damaging Het
Celf4 C T 18: 25,486,793 probably null Het
Cep57l1 G A 10: 41,745,842 T26M possibly damaging Het
Ces2g T A 8: 104,966,852 D388E probably benign Het
Cir1 T C 2: 73,306,890 N69S possibly damaging Het
Ctc1 C A 11: 69,026,344 H355N probably benign Het
Ebf2 A T 14: 67,424,040 K539M probably damaging Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fat2 C T 11: 55,284,796 G1697E probably damaging Het
Fga A G 3: 83,029,125 D76G probably damaging Het
Fn1 A T 1: 71,603,735 S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 E18D probably damaging Het
Gbp8 A T 5: 105,031,294 I113N probably damaging Het
Gm10549 A T 18: 33,470,859 R132* probably null Het
Gmps T A 3: 63,985,653 D126E possibly damaging Het
Gria4 A G 9: 4,472,074 Y472H probably damaging Het
Helz2 T C 2: 181,231,996 Y2235C probably damaging Het
Hrnr A G 3: 93,323,016 N187S unknown Het
Ifit1bl1 T C 19: 34,594,005 K351E probably benign Het
Klhl23 A G 2: 69,824,712 T309A probably benign Het
Ldhal6b A G 17: 5,418,602 V19A probably benign Het
Lrrc59 C T 11: 94,643,344 R243C probably damaging Het
Magi3 A C 3: 104,015,927 I1158R probably benign Het
Mical2 T A 7: 112,323,626 Y613N probably damaging Het
Myoc T A 1: 162,639,827 probably null Het
Npas3 C A 12: 54,068,341 S682Y possibly damaging Het
Ogdh T C 11: 6,324,887 V172A probably benign Het
Olfr1076 A G 2: 86,508,605 T49A probably damaging Het
Olfr284 A T 15: 98,340,894 S32T possibly damaging Het
Olfr325 T A 11: 58,581,382 H179Q probably benign Het
Olfr584 T A 7: 103,086,263 C243* probably null Het
Olfr682-ps1 A G 7: 105,128,252 Y52H probably damaging Het
P2rx7 A T 5: 122,673,373 I331F probably benign Het
Pcdhb14 A T 18: 37,448,884 T348S possibly damaging Het
Prdx6b A G 2: 80,293,402 E185G probably benign Het
Rdh1 A G 10: 127,764,707 K200E possibly damaging Het
Sema6c A T 3: 95,173,199 R935W probably damaging Het
Serpinb5 A T 1: 106,875,142 I136F probably damaging Het
Skint10 A T 4: 112,765,092 Y31* probably null Het
St6galnac1 C T 11: 116,766,072 probably null Het
Synj1 G A 16: 90,961,499 T819M probably damaging Het
Tacr3 T A 3: 134,929,908 V291E probably damaging Het
Tdo2 A G 3: 81,968,083 probably null Het
Tex15 T A 8: 33,546,263 D72E possibly damaging Het
Tph2 T C 10: 115,079,822 T438A probably benign Het
Uaca A G 9: 60,869,905 T525A probably benign Het
Ulk1 A T 5: 110,792,404 C384S probably benign Het
Uvrag T C 7: 98,991,963 D290G probably benign Het
Zfp541 T C 7: 16,071,994 L18P probably damaging Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 122865323 intron probably benign
IGL01958:Cdh15 APN 8 122859350 missense probably damaging 1.00
IGL02588:Cdh15 APN 8 122856552 nonsense probably null
IGL02793:Cdh15 APN 8 122860982 missense probably damaging 1.00
IGL02947:Cdh15 APN 8 122865372 missense probably benign 0.00
R0310:Cdh15 UTSW 8 122865436 missense probably damaging 1.00
R0441:Cdh15 UTSW 8 122860966 missense probably damaging 1.00
R0766:Cdh15 UTSW 8 122861449 intron probably benign
R0898:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1023:Cdh15 UTSW 8 122865200 missense probably damaging 0.98
R1054:Cdh15 UTSW 8 122864337 missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R1081:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1101:Cdh15 UTSW 8 122860846 missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1209:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1210:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1312:Cdh15 UTSW 8 122861449 intron probably benign
R1317:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1318:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1393:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1428:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1429:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1695:Cdh15 UTSW 8 122862016 missense probably benign 0.05
R2157:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2170:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2178:Cdh15 UTSW 8 122864976 splice site probably null
R2252:Cdh15 UTSW 8 122857422 missense probably damaging 1.00
R2290:Cdh15 UTSW 8 122859317 missense probably damaging 1.00
R2317:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2330:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2345:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2349:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2353:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2354:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2566:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2567:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2568:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2893:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2894:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2937:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2938:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2990:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2992:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2993:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3029:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3030:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3195:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R3441:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3442:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3608:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3686:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4119:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4120:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4477:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4478:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4480:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4580:Cdh15 UTSW 8 122865158 missense probably damaging 0.99
R4583:Cdh15 UTSW 8 122865028 missense probably damaging 0.98
R4619:Cdh15 UTSW 8 122860873 missense probably damaging 1.00
R4694:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4731:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R5076:Cdh15 UTSW 8 122864348 missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 122862063 missense probably null 1.00
R5375:Cdh15 UTSW 8 122865100 missense probably damaging 1.00
R5498:Cdh15 UTSW 8 122865178 missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 122856587 missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 122864347 missense probably benign 0.01
R6570:Cdh15 UTSW 8 122857391 missense probably damaging 1.00
R6708:Cdh15 UTSW 8 122863555 missense probably benign 0.32
R7505:Cdh15 UTSW 8 122848492 missense probably benign 0.01
R7527:Cdh15 UTSW 8 122862126 missense probably damaging 1.00
R8093:Cdh15 UTSW 8 122866835 missense probably damaging 1.00
R8485:Cdh15 UTSW 8 122857366 missense probably damaging 1.00
R8759:Cdh15 UTSW 8 122860889 missense probably damaging 1.00
R8910:Cdh15 UTSW 8 122848501 missense probably benign 0.04
Z1176:Cdh15 UTSW 8 122864259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCATCTTAAAAGAGACAGGG -3'
(R):5'- CCATGCTGTTGACCCTCATAGG -3'

Sequencing Primer
(F):5'- CTGTAGCTGAGCACCAGAG -3'
(R):5'- GATTTCTGGGTGCACATCCCAAG -3'
Posted On2019-11-12