Incidental Mutation 'R7724:Gria4'
ID595400
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R7724 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4472074 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 472 (Y472H)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably damaging
Transcript: ENSMUST00000027020
AA Change: Y472H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: Y472H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063508
AA Change: Y472H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: Y472H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212533
AA Change: Y472H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,250 N148D possibly damaging Het
9130401M01Rik A C 15: 58,022,461 S342A probably benign Het
Adarb2 C A 13: 8,570,256 H259Q probably benign Het
Ak7 T A 12: 105,716,030 I150N probably damaging Het
Arhgef12 A T 9: 43,027,271 I75N probably damaging Het
Arhgef17 C T 7: 100,880,609 G480S probably damaging Het
Atic T C 1: 71,564,901 Y208H probably damaging Het
Atp8b4 T A 2: 126,322,893 N1168Y possibly damaging Het
Cdh15 G T 8: 122,866,961 D765Y probably damaging Het
Celf4 C T 18: 25,486,793 probably null Het
Cep57l1 G A 10: 41,745,842 T26M possibly damaging Het
Ces2g T A 8: 104,966,852 D388E probably benign Het
Cir1 T C 2: 73,306,890 N69S possibly damaging Het
Ctc1 C A 11: 69,026,344 H355N probably benign Het
Ebf2 A T 14: 67,424,040 K539M probably damaging Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fat2 C T 11: 55,284,796 G1697E probably damaging Het
Fga A G 3: 83,029,125 D76G probably damaging Het
Fn1 A T 1: 71,603,735 S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 E18D probably damaging Het
Gbp8 A T 5: 105,031,294 I113N probably damaging Het
Gm10549 A T 18: 33,470,859 R132* probably null Het
Gmps T A 3: 63,985,653 D126E possibly damaging Het
Helz2 T C 2: 181,231,996 Y2235C probably damaging Het
Hrnr A G 3: 93,323,016 N187S unknown Het
Ifit1bl1 T C 19: 34,594,005 K351E probably benign Het
Klhl23 A G 2: 69,824,712 T309A probably benign Het
Ldhal6b A G 17: 5,418,602 V19A probably benign Het
Lrrc59 C T 11: 94,643,344 R243C probably damaging Het
Magi3 A C 3: 104,015,927 I1158R probably benign Het
Mical2 T A 7: 112,323,626 Y613N probably damaging Het
Myoc T A 1: 162,639,827 probably null Het
Npas3 C A 12: 54,068,341 S682Y possibly damaging Het
Ogdh T C 11: 6,324,887 V172A probably benign Het
Olfr1076 A G 2: 86,508,605 T49A probably damaging Het
Olfr284 A T 15: 98,340,894 S32T possibly damaging Het
Olfr325 T A 11: 58,581,382 H179Q probably benign Het
Olfr584 T A 7: 103,086,263 C243* probably null Het
Olfr682-ps1 A G 7: 105,128,252 Y52H probably damaging Het
P2rx7 A T 5: 122,673,373 I331F probably benign Het
Pcdhb14 A T 18: 37,448,884 T348S possibly damaging Het
Prdx6b A G 2: 80,293,402 E185G probably benign Het
Rdh1 A G 10: 127,764,707 K200E possibly damaging Het
Sema6c A T 3: 95,173,199 R935W probably damaging Het
Serpinb5 A T 1: 106,875,142 I136F probably damaging Het
Skint10 A T 4: 112,765,092 Y31* probably null Het
St6galnac1 C T 11: 116,766,072 probably null Het
Synj1 G A 16: 90,961,499 T819M probably damaging Het
Tacr3 T A 3: 134,929,908 V291E probably damaging Het
Tdo2 A G 3: 81,968,083 probably null Het
Tex15 T A 8: 33,546,263 D72E possibly damaging Het
Tph2 T C 10: 115,079,822 T438A probably benign Het
Uaca A G 9: 60,869,905 T525A probably benign Het
Ulk1 A T 5: 110,792,404 C384S probably benign Het
Uvrag T C 7: 98,991,963 D290G probably benign Het
Zfp541 T C 7: 16,071,994 L18P probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7909:Gria4 UTSW 9 4464450 missense probably damaging 1.00
R8007:Gria4 UTSW 9 4503740 splice site probably benign
R8044:Gria4 UTSW 9 4456216 missense probably damaging 1.00
R8062:Gria4 UTSW 9 4480273 missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4502429 missense probably benign 0.16
R8212:Gria4 UTSW 9 4480242 missense probably benign
R8478:Gria4 UTSW 9 4793882 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424347 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424351 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4456106 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4795189 missense possibly damaging 0.92
R8888:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R8895:Gria4 UTSW 9 4664951 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATTCTAGGTCTCCAGAATCCAGTTC -3'
(R):5'- TTCTAGCCACACAAAGTCATATGC -3'

Sequencing Primer
(F):5'- CCAAGGGAAAAGAAGCTTC -3'
(R):5'- CCATCTTTTGCCAAAACTTCTAAAGC -3'
Posted On2019-11-12