Incidental Mutation 'R7724:Cep57l1'
ID595403
Institutional Source Beutler Lab
Gene Symbol Cep57l1
Ensembl Gene ENSMUSG00000019813
Gene Namecentrosomal protein 57-like 1
Synonyms4930484D11Rik, 2410017P07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7724 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41718840-41809871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41745842 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 26 (T26M)
Ref Sequence ENSEMBL: ENSMUSP00000139509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019951] [ENSMUST00000105505] [ENSMUST00000186239] [ENSMUST00000187143] [ENSMUST00000189770] [ENSMUST00000190022] [ENSMUST00000191498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019951
AA Change: T26M

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019951
Gene: ENSMUSG00000019813
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 1.2e-64 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 283 356 2.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105505
AA Change: T26M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101144
Gene: ENSMUSG00000019813
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186239
AA Change: T26M

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139509
Gene: ENSMUSG00000019813
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 2.3e-72 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 281 356 1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187143
AA Change: T26M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140389
Gene: ENSMUSG00000019813
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189770
AA Change: T26M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140147
Gene: ENSMUSG00000019813
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190022
AA Change: T26M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141031
Gene: ENSMUSG00000019813
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Cep57_CLD 45 151 6.6e-38 PFAM
low complexity region 158 169 N/A INTRINSIC
Pfam:Cep57_MT_bd 205 280 1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191498
AA Change: T26M

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141089
Gene: ENSMUSG00000019813
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 229 1.9e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,250 N148D possibly damaging Het
9130401M01Rik A C 15: 58,022,461 S342A probably benign Het
Adarb2 C A 13: 8,570,256 H259Q probably benign Het
Ak7 T A 12: 105,716,030 I150N probably damaging Het
Arhgef12 A T 9: 43,027,271 I75N probably damaging Het
Arhgef17 C T 7: 100,880,609 G480S probably damaging Het
Atic T C 1: 71,564,901 Y208H probably damaging Het
Atp8b4 T A 2: 126,322,893 N1168Y possibly damaging Het
Cdh15 G T 8: 122,866,961 D765Y probably damaging Het
Celf4 C T 18: 25,486,793 probably null Het
Ces2g T A 8: 104,966,852 D388E probably benign Het
Cir1 T C 2: 73,306,890 N69S possibly damaging Het
Ctc1 C A 11: 69,026,344 H355N probably benign Het
Ebf2 A T 14: 67,424,040 K539M probably damaging Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fat2 C T 11: 55,284,796 G1697E probably damaging Het
Fga A G 3: 83,029,125 D76G probably damaging Het
Fn1 A T 1: 71,603,735 S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 E18D probably damaging Het
Gbp8 A T 5: 105,031,294 I113N probably damaging Het
Gm10549 A T 18: 33,470,859 R132* probably null Het
Gmps T A 3: 63,985,653 D126E possibly damaging Het
Gria4 A G 9: 4,472,074 Y472H probably damaging Het
Helz2 T C 2: 181,231,996 Y2235C probably damaging Het
Hrnr A G 3: 93,323,016 N187S unknown Het
Ifit1bl1 T C 19: 34,594,005 K351E probably benign Het
Klhl23 A G 2: 69,824,712 T309A probably benign Het
Ldhal6b A G 17: 5,418,602 V19A probably benign Het
Lrrc59 C T 11: 94,643,344 R243C probably damaging Het
Magi3 A C 3: 104,015,927 I1158R probably benign Het
Mical2 T A 7: 112,323,626 Y613N probably damaging Het
Myoc T A 1: 162,639,827 probably null Het
Npas3 C A 12: 54,068,341 S682Y possibly damaging Het
Ogdh T C 11: 6,324,887 V172A probably benign Het
Olfr1076 A G 2: 86,508,605 T49A probably damaging Het
Olfr284 A T 15: 98,340,894 S32T possibly damaging Het
Olfr325 T A 11: 58,581,382 H179Q probably benign Het
Olfr584 T A 7: 103,086,263 C243* probably null Het
Olfr682-ps1 A G 7: 105,128,252 Y52H probably damaging Het
P2rx7 A T 5: 122,673,373 I331F probably benign Het
Pcdhb14 A T 18: 37,448,884 T348S possibly damaging Het
Prdx6b A G 2: 80,293,402 E185G probably benign Het
Rdh1 A G 10: 127,764,707 K200E possibly damaging Het
Sema6c A T 3: 95,173,199 R935W probably damaging Het
Serpinb5 A T 1: 106,875,142 I136F probably damaging Het
Skint10 A T 4: 112,765,092 Y31* probably null Het
St6galnac1 C T 11: 116,766,072 probably null Het
Synj1 G A 16: 90,961,499 T819M probably damaging Het
Tacr3 T A 3: 134,929,908 V291E probably damaging Het
Tdo2 A G 3: 81,968,083 probably null Het
Tex15 T A 8: 33,546,263 D72E possibly damaging Het
Tph2 T C 10: 115,079,822 T438A probably benign Het
Uaca A G 9: 60,869,905 T525A probably benign Het
Ulk1 A T 5: 110,792,404 C384S probably benign Het
Uvrag T C 7: 98,991,963 D290G probably benign Het
Zfp541 T C 7: 16,071,994 L18P probably damaging Het
Other mutations in Cep57l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep57l1 APN 10 41721551 intron probably benign
IGL00679:Cep57l1 APN 10 41719800 nonsense probably null
IGL00839:Cep57l1 APN 10 41731093 missense probably damaging 1.00
IGL01013:Cep57l1 APN 10 41740869 nonsense probably null
IGL01479:Cep57l1 APN 10 41728639 missense possibly damaging 0.95
IGL01830:Cep57l1 APN 10 41728653 missense probably benign 0.03
IGL02005:Cep57l1 APN 10 41740961 missense probably benign 0.39
IGL02679:Cep57l1 APN 10 41729386 missense probably damaging 1.00
IGL02697:Cep57l1 APN 10 41722954 missense possibly damaging 0.83
IGL03328:Cep57l1 APN 10 41743152 missense probably damaging 1.00
R2147:Cep57l1 UTSW 10 41740899 missense probably damaging 0.97
R3712:Cep57l1 UTSW 10 41743114 missense probably damaging 1.00
R4049:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4050:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4661:Cep57l1 UTSW 10 41719771 missense possibly damaging 0.91
R4764:Cep57l1 UTSW 10 41721682 missense possibly damaging 0.81
R4929:Cep57l1 UTSW 10 41745914 missense possibly damaging 0.93
R6058:Cep57l1 UTSW 10 41740922 missense possibly damaging 0.87
R6386:Cep57l1 UTSW 10 41743132 missense probably damaging 1.00
R6788:Cep57l1 UTSW 10 41743149 missense probably damaging 1.00
R7334:Cep57l1 UTSW 10 41721600 missense probably benign 0.00
R7738:Cep57l1 UTSW 10 41740846 missense probably damaging 1.00
R7792:Cep57l1 UTSW 10 41722940 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTAGCCTCGTGATTAACAG -3'
(R):5'- TACATCTGGGTAGTGTATTGCTAACAG -3'

Sequencing Primer
(F):5'- CGTGATTAACAGTTGTGTGACTACTC -3'
(R):5'- AGTGTATTGCTAACAGCTATGTGC -3'
Posted On2019-11-12