Mutagenetix > Incidental Mutations

Incidental Mutation 'R7724:Tph2'

595404

Institutional Source

Beutler Lab

Gene Symbol

Tph2

Ensembl Gene

ENSMUSG00000006764

Gene Name

tryptophan hydroxylase 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.400) question?

Stock #

R7724 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

115078641-115185022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115079822 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 438 (T438A)

Ref Sequence

ENSEMBL: ENSMUSP00000006949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006949]

Predicted Effect

probably benign
Transcript: ENSMUST00000006949
AA Change: T438A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: T438A

Domain	Start	End	E-Value	Type
low complexity region	94	102	N/A	INTRINSIC
Pfam:Biopterin_H	150	480	3.6e-177	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	A	G	14: 95,882,250	N148D	possibly damaging	Het
9130401M01Rik	A	C	15: 58,022,461	S342A	probably benign	Het
Adarb2	C	A	13: 8,570,256	H259Q	probably benign	Het
Ak7	T	A	12: 105,716,030	I150N	probably damaging	Het
Arhgef12	A	T	9: 43,027,271	I75N	probably damaging	Het
Arhgef17	C	T	7: 100,880,609	G480S	probably damaging	Het
Atic	T	C	1: 71,564,901	Y208H	probably damaging	Het
Atp8b4	T	A	2: 126,322,893	N1168Y	possibly damaging	Het
Cdh15	G	T	8: 122,866,961	D765Y	probably damaging	Het
Celf4	C	T	18: 25,486,793		probably null	Het
Cep57l1	G	A	10: 41,745,842	T26M	possibly damaging	Het
Ces2g	T	A	8: 104,966,852	D388E	probably benign	Het
Cir1	T	C	2: 73,306,890	N69S	possibly damaging	Het
Ctc1	C	A	11: 69,026,344	H355N	probably benign	Het
Ebf2	A	T	14: 67,424,040	K539M	probably damaging	Het
Ehbp1	G	A	11: 22,089,572	H843Y	probably null	Het
Fat2	C	T	11: 55,284,796	G1697E	probably damaging	Het
Fga	A	G	3: 83,029,125	D76G	probably damaging	Het
Fn1	A	T	1: 71,603,735	S1786T	probably benign	Het
Frmpd1	A	T	4: 45,229,888	E18D	probably damaging	Het
Gbp8	A	T	5: 105,031,294	I113N	probably damaging	Het
Gm10549	A	T	18: 33,470,859	R132*	probably null	Het
Gmps	T	A	3: 63,985,653	D126E	possibly damaging	Het
Gria4	A	G	9: 4,472,074	Y472H	probably damaging	Het
Helz2	T	C	2: 181,231,996	Y2235C	probably damaging	Het
Hrnr	A	G	3: 93,323,016	N187S	unknown	Het
Ifit1bl1	T	C	19: 34,594,005	K351E	probably benign	Het
Klhl23	A	G	2: 69,824,712	T309A	probably benign	Het
Ldhal6b	A	G	17: 5,418,602	V19A	probably benign	Het
Lrrc59	C	T	11: 94,643,344	R243C	probably damaging	Het
Magi3	A	C	3: 104,015,927	I1158R	probably benign	Het
Mical2	T	A	7: 112,323,626	Y613N	probably damaging	Het
Myoc	T	A	1: 162,639,827		probably null	Het
Npas3	C	A	12: 54,068,341	S682Y	possibly damaging	Het
Ogdh	T	C	11: 6,324,887	V172A	probably benign	Het
Olfr1076	A	G	2: 86,508,605	T49A	probably damaging	Het
Olfr284	A	T	15: 98,340,894	S32T	possibly damaging	Het
Olfr325	T	A	11: 58,581,382	H179Q	probably benign	Het
Olfr584	T	A	7: 103,086,263	C243*	probably null	Het
Olfr682-ps1	A	G	7: 105,128,252	Y52H	probably damaging	Het
P2rx7	A	T	5: 122,673,373	I331F	probably benign	Het
Pcdhb14	A	T	18: 37,448,884	T348S	possibly damaging	Het
Prdx6b	A	G	2: 80,293,402	E185G	probably benign	Het
Rdh1	A	G	10: 127,764,707	K200E	possibly damaging	Het
Sema6c	A	T	3: 95,173,199	R935W	probably damaging	Het
Serpinb5	A	T	1: 106,875,142	I136F	probably damaging	Het
Skint10	A	T	4: 112,765,092	Y31*	probably null	Het
St6galnac1	C	T	11: 116,766,072		probably null	Het
Synj1	G	A	16: 90,961,499	T819M	probably damaging	Het
Tacr3	T	A	3: 134,929,908	V291E	probably damaging	Het
Tdo2	A	G	3: 81,968,083		probably null	Het
Tex15	T	A	8: 33,546,263	D72E	possibly damaging	Het
Uaca	A	G	9: 60,869,905	T525A	probably benign	Het
Ulk1	A	T	5: 110,792,404	C384S	probably benign	Het
Uvrag	T	C	7: 98,991,963	D290G	probably benign	Het
Zfp541	T	C	7: 16,071,994	L18P	probably damaging	Het

Other mutations in Tph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Tph2	APN	10	115079759	nonsense	probably null
IGL01989:Tph2	APN	10	115146016	missense	probably benign	0.22
IGL02363:Tph2	APN	10	115079981	missense	probably benign	0.01
IGL02667:Tph2	APN	10	115080045	missense	probably benign	0.43
R0390:Tph2	UTSW	10	115174109	missense	probably damaging	1.00
R0400:Tph2	UTSW	10	115080120	splice site	probably benign
R0570:Tph2	UTSW	10	115174134	splice site	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1654:Tph2	UTSW	10	115184807	missense	probably benign
R3705:Tph2	UTSW	10	115119893	nonsense	probably null
R3710:Tph2	UTSW	10	115174058	missense	probably benign	0.42
R3777:Tph2	UTSW	10	115080005	missense	probably benign
R4794:Tph2	UTSW	10	115182770	missense	possibly damaging	0.84
R5015:Tph2	UTSW	10	115079716	missense	probably benign	0.01
R5068:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5069:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5070:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5422:Tph2	UTSW	10	115079764	missense	possibly damaging	0.94
R5487:Tph2	UTSW	10	115119874	missense	probably damaging	1.00
R5604:Tph2	UTSW	10	115090709	missense	probably damaging	1.00
R5692:Tph2	UTSW	10	115184827	missense	probably damaging	0.97
R6368:Tph2	UTSW	10	115179326	missense	probably damaging	1.00
R6802:Tph2	UTSW	10	115184873	missense	probably damaging	1.00
R6823:Tph2	UTSW	10	115174106	missense	probably benign	0.02
R7371:Tph2	UTSW	10	115151111	missense	probably damaging	1.00
R7863:Tph2	UTSW	10	115080001	missense	probably damaging	1.00
R8046:Tph2	UTSW	10	115179594	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CTCATGCTGACAATAACTCTGGTTC -3'
(R):5'- CCACCTTTCAGGACGCTTAC -3'

Sequencing Primer
(F):5'- GCTGACAATAACTCTGGTTCTAGGC -3'
(R):5'- TTCGGACAGTTTTGAAGAAGCC -3'

Posted On

2019-11-12