Incidental Mutation 'R7724:Rdh1'
ID 595405
Institutional Source Beutler Lab
Gene Symbol Rdh1
Ensembl Gene ENSMUSG00000089789
Gene Name retinol dehydrogenase 1 (all trans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7724 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 127759721-127768297 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127764707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 200 (K200E)
Ref Sequence ENSEMBL: ENSMUSP00000073322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073639] [ENSMUST00000128247]
AlphaFold Q8CGV4
Predicted Effect possibly damaging
Transcript: ENSMUST00000073639
AA Change: K200E

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073322
Gene: ENSMUSG00000089789
AA Change: K200E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 222 5.7e-43 PFAM
Pfam:DUF1776 43 303 3.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128247
SMART Domains Protein: ENSMUSP00000116574
Gene: ENSMUSG00000099009

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 195 1.7e-23 PFAM
Pfam:DUF1776 43 303 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, adipose tissue, and retinol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,250 N148D possibly damaging Het
9130401M01Rik A C 15: 58,022,461 S342A probably benign Het
Adarb2 C A 13: 8,570,256 H259Q probably benign Het
Ak7 T A 12: 105,716,030 I150N probably damaging Het
Arhgef12 A T 9: 43,027,271 I75N probably damaging Het
Arhgef17 C T 7: 100,880,609 G480S probably damaging Het
Atic T C 1: 71,564,901 Y208H probably damaging Het
Atp8b4 T A 2: 126,322,893 N1168Y possibly damaging Het
Cdh15 G T 8: 122,866,961 D765Y probably damaging Het
Celf4 C T 18: 25,486,793 probably null Het
Cep57l1 G A 10: 41,745,842 T26M possibly damaging Het
Ces2g T A 8: 104,966,852 D388E probably benign Het
Cir1 T C 2: 73,306,890 N69S possibly damaging Het
Ctc1 C A 11: 69,026,344 H355N probably benign Het
Ebf2 A T 14: 67,424,040 K539M probably damaging Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fat2 C T 11: 55,284,796 G1697E probably damaging Het
Fga A G 3: 83,029,125 D76G probably damaging Het
Fn1 A T 1: 71,603,735 S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 E18D probably damaging Het
Gbp8 A T 5: 105,031,294 I113N probably damaging Het
Gm10549 A T 18: 33,470,859 R132* probably null Het
Gmps T A 3: 63,985,653 D126E possibly damaging Het
Gria4 A G 9: 4,472,074 Y472H probably damaging Het
Helz2 T C 2: 181,231,996 Y2235C probably damaging Het
Hrnr A G 3: 93,323,016 N187S unknown Het
Ifit1bl1 T C 19: 34,594,005 K351E probably benign Het
Klhl23 A G 2: 69,824,712 T309A probably benign Het
Ldhal6b A G 17: 5,418,602 V19A probably benign Het
Lrrc59 C T 11: 94,643,344 R243C probably damaging Het
Magi3 A C 3: 104,015,927 I1158R probably benign Het
Mical2 T A 7: 112,323,626 Y613N probably damaging Het
Myoc T A 1: 162,639,827 probably null Het
Npas3 C A 12: 54,068,341 S682Y possibly damaging Het
Ogdh T C 11: 6,324,887 V172A probably benign Het
Olfr1076 A G 2: 86,508,605 T49A probably damaging Het
Olfr284 A T 15: 98,340,894 S32T possibly damaging Het
Olfr325 T A 11: 58,581,382 H179Q probably benign Het
Olfr584 T A 7: 103,086,263 C243* probably null Het
Olfr682-ps1 A G 7: 105,128,252 Y52H probably damaging Het
P2rx7 A T 5: 122,673,373 I331F probably benign Het
Pcdhb14 A T 18: 37,448,884 T348S possibly damaging Het
Prdx6b A G 2: 80,293,402 E185G probably benign Het
Sema6c A T 3: 95,173,199 R935W probably damaging Het
Serpinb5 A T 1: 106,875,142 I136F probably damaging Het
Skint10 A T 4: 112,765,092 Y31* probably null Het
St6galnac1 C T 11: 116,766,072 probably null Het
Synj1 G A 16: 90,961,499 T819M probably damaging Het
Tacr3 T A 3: 134,929,908 V291E probably damaging Het
Tdo2 A G 3: 81,968,083 probably null Het
Tex15 T A 8: 33,546,263 D72E possibly damaging Het
Tph2 T C 10: 115,079,822 T438A probably benign Het
Uaca A G 9: 60,869,905 T525A probably benign Het
Ulk1 A T 5: 110,792,404 C384S probably benign Het
Uvrag T C 7: 98,991,963 D290G probably benign Het
Zfp541 T C 7: 16,071,994 L18P probably damaging Het
Other mutations in Rdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02745:Rdh1 APN 10 127765419 missense probably benign 0.06
R0077:Rdh1 UTSW 10 127760037 missense probably damaging 1.00
R0481:Rdh1 UTSW 10 127763124 missense probably damaging 1.00
R0511:Rdh1 UTSW 10 127764783 missense probably benign
R0558:Rdh1 UTSW 10 127759941 missense possibly damaging 0.88
R1569:Rdh1 UTSW 10 127763072 missense probably benign
R1993:Rdh1 UTSW 10 127765345 missense probably benign
R2164:Rdh1 UTSW 10 127760172 missense possibly damaging 0.89
R3021:Rdh1 UTSW 10 127760208 missense possibly damaging 0.91
R5268:Rdh1 UTSW 10 127759963 missense possibly damaging 0.67
R6126:Rdh1 UTSW 10 127763214 missense probably damaging 1.00
R6216:Rdh1 UTSW 10 127764753 missense probably benign 0.00
R7017:Rdh1 UTSW 10 127763037 missense probably benign 0.02
R7332:Rdh1 UTSW 10 127759885 start gained probably benign
R7397:Rdh1 UTSW 10 127760178 missense probably benign 0.24
R7721:Rdh1 UTSW 10 127760252 critical splice donor site probably null
R7873:Rdh1 UTSW 10 127760023 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCACCCGCCAAATACTGTG -3'
(R):5'- AGACTCAAGTTGGCTTTGTTCCC -3'

Sequencing Primer
(F):5'- TACTGTGCGGCATTCACAAG -3'
(R):5'- AAGTTGGCTTTGTTCCCCCAAAATC -3'
Posted On 2019-11-12