Incidental Mutation 'R7724:Ogdh'
ID 595406
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Name oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms alpha-ketoglutarate dehydrogenase, 2210403E04Rik, 2210412K19Rik, d1401
MMRRC Submission 045780-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7724 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 6241633-6306642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6274887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000091041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000101554]
AlphaFold Q60597
PDB Structure Structure of the m67 high-affinity mutant of the 2C TCR in complex with Ld/QL9 [X-RAY DIFFRACTION]
42F3 QL9/H2-Ld complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003461
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081894
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093350
AA Change: V172A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456
AA Change: V172A

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101554
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A C 15: 57,885,857 (GRCm39) S342A probably benign Het
Adarb2 C A 13: 8,620,292 (GRCm39) H259Q probably benign Het
Ak7 T A 12: 105,682,289 (GRCm39) I150N probably damaging Het
Arhgef12 A T 9: 42,938,567 (GRCm39) I75N probably damaging Het
Arhgef17 C T 7: 100,529,816 (GRCm39) G480S probably damaging Het
Atic T C 1: 71,604,060 (GRCm39) Y208H probably damaging Het
Atp8b4 T A 2: 126,164,813 (GRCm39) N1168Y possibly damaging Het
Ccdc202 A G 14: 96,119,686 (GRCm39) N148D possibly damaging Het
Cdh15 G T 8: 123,593,700 (GRCm39) D765Y probably damaging Het
Celf4 C T 18: 25,619,850 (GRCm39) probably null Het
Cep57l1 G A 10: 41,621,838 (GRCm39) T26M possibly damaging Het
Ces2g T A 8: 105,693,484 (GRCm39) D388E probably benign Het
Cir1 T C 2: 73,137,234 (GRCm39) N69S possibly damaging Het
Ctc1 C A 11: 68,917,170 (GRCm39) H355N probably benign Het
Ebf2 A T 14: 67,661,489 (GRCm39) K539M probably damaging Het
Ehbp1 G A 11: 22,039,572 (GRCm39) H843Y probably null Het
Fat2 C T 11: 55,175,622 (GRCm39) G1697E probably damaging Het
Fga A G 3: 82,936,432 (GRCm39) D76G probably damaging Het
Fn1 A T 1: 71,642,894 (GRCm39) S1786T probably benign Het
Frmpd1 A T 4: 45,229,888 (GRCm39) E18D probably damaging Het
Gbp8 A T 5: 105,179,160 (GRCm39) I113N probably damaging Het
Gm10549 A T 18: 33,603,912 (GRCm39) R132* probably null Het
Gmps T A 3: 63,893,074 (GRCm39) D126E possibly damaging Het
Gria4 A G 9: 4,472,074 (GRCm39) Y472H probably damaging Het
Helz2 T C 2: 180,873,789 (GRCm39) Y2235C probably damaging Het
Hrnr A G 3: 93,230,323 (GRCm39) N187S unknown Het
Ifit1bl1 T C 19: 34,571,405 (GRCm39) K351E probably benign Het
Klhl23 A G 2: 69,655,056 (GRCm39) T309A probably benign Het
Ldhal6b A G 17: 5,468,877 (GRCm39) V19A probably benign Het
Lrrc59 C T 11: 94,534,170 (GRCm39) R243C probably damaging Het
Magi3 A C 3: 103,923,243 (GRCm39) I1158R probably benign Het
Mical2 T A 7: 111,922,833 (GRCm39) Y613N probably damaging Het
Myoc T A 1: 162,467,396 (GRCm39) probably null Het
Npas3 C A 12: 54,115,124 (GRCm39) S682Y possibly damaging Het
Or2t46 T A 11: 58,472,208 (GRCm39) H179Q probably benign Het
Or52r1c T A 7: 102,735,470 (GRCm39) C243* probably null Het
Or56a42-ps1 A G 7: 104,777,459 (GRCm39) Y52H probably damaging Het
Or8k30 A G 2: 86,338,949 (GRCm39) T49A probably damaging Het
Or8s5 A T 15: 98,238,775 (GRCm39) S32T possibly damaging Het
P2rx7 A T 5: 122,811,436 (GRCm39) I331F probably benign Het
Pcdhb14 A T 18: 37,581,937 (GRCm39) T348S possibly damaging Het
Prdx6b A G 2: 80,123,746 (GRCm39) E185G probably benign Het
Rdh1 A G 10: 127,600,576 (GRCm39) K200E possibly damaging Het
Sema6c A T 3: 95,080,510 (GRCm39) R935W probably damaging Het
Serpinb5 A T 1: 106,802,872 (GRCm39) I136F probably damaging Het
Skint10 A T 4: 112,622,289 (GRCm39) Y31* probably null Het
St6galnac1 C T 11: 116,656,898 (GRCm39) probably null Het
Synj1 G A 16: 90,758,387 (GRCm39) T819M probably damaging Het
Tacr3 T A 3: 134,635,669 (GRCm39) V291E probably damaging Het
Tdo2 A G 3: 81,875,390 (GRCm39) probably null Het
Tex15 T A 8: 34,036,291 (GRCm39) D72E possibly damaging Het
Tph2 T C 10: 114,915,727 (GRCm39) T438A probably benign Het
Uaca A G 9: 60,777,187 (GRCm39) T525A probably benign Het
Ulk1 A T 5: 110,940,270 (GRCm39) C384S probably benign Het
Uvrag T C 7: 98,641,170 (GRCm39) D290G probably benign Het
Zfp541 T C 7: 15,805,919 (GRCm39) L18P probably damaging Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6,298,790 (GRCm39) missense probably damaging 1.00
IGL01503:Ogdh APN 11 6,305,069 (GRCm39) missense probably damaging 1.00
IGL01684:Ogdh APN 11 6,292,546 (GRCm39) missense probably damaging 1.00
IGL02141:Ogdh APN 11 6,305,015 (GRCm39) missense probably damaging 1.00
IGL02313:Ogdh APN 11 6,305,400 (GRCm39) missense probably damaging 0.98
IGL02818:Ogdh APN 11 6,298,270 (GRCm39) missense probably benign
N/A - 535:Ogdh UTSW 11 6,274,911 (GRCm39) missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6,290,504 (GRCm39) missense probably benign 0.09
R0328:Ogdh UTSW 11 6,297,216 (GRCm39) missense probably benign 0.01
R0505:Ogdh UTSW 11 6,289,936 (GRCm39) splice site probably benign
R0627:Ogdh UTSW 11 6,297,216 (GRCm39) missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6,290,544 (GRCm39) missense probably damaging 1.00
R1480:Ogdh UTSW 11 6,297,827 (GRCm39) critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6,299,384 (GRCm39) missense probably damaging 1.00
R1804:Ogdh UTSW 11 6,288,565 (GRCm39) missense probably damaging 1.00
R1873:Ogdh UTSW 11 6,290,438 (GRCm39) splice site probably benign
R1959:Ogdh UTSW 11 6,296,638 (GRCm39) missense possibly damaging 0.49
R2004:Ogdh UTSW 11 6,284,626 (GRCm39) missense possibly damaging 0.90
R2080:Ogdh UTSW 11 6,299,393 (GRCm39) missense probably benign 0.00
R2384:Ogdh UTSW 11 6,292,526 (GRCm39) missense probably damaging 1.00
R2656:Ogdh UTSW 11 6,298,678 (GRCm39) missense probably benign
R2883:Ogdh UTSW 11 6,284,545 (GRCm39) missense probably damaging 1.00
R3405:Ogdh UTSW 11 6,299,462 (GRCm39) missense probably damaging 1.00
R3838:Ogdh UTSW 11 6,288,627 (GRCm39) nonsense probably null
R3933:Ogdh UTSW 11 6,292,601 (GRCm39) missense possibly damaging 0.72
R3939:Ogdh UTSW 11 6,300,655 (GRCm39) nonsense probably null
R4296:Ogdh UTSW 11 6,299,374 (GRCm39) missense probably damaging 0.97
R4393:Ogdh UTSW 11 6,266,772 (GRCm39) missense probably damaging 1.00
R4427:Ogdh UTSW 11 6,305,421 (GRCm39) missense probably benign 0.01
R4667:Ogdh UTSW 11 6,290,600 (GRCm39) missense probably benign 0.20
R4669:Ogdh UTSW 11 6,290,600 (GRCm39) missense probably benign 0.20
R4728:Ogdh UTSW 11 6,292,549 (GRCm39) missense probably damaging 1.00
R4737:Ogdh UTSW 11 6,247,044 (GRCm39) missense probably benign
R4785:Ogdh UTSW 11 6,299,875 (GRCm39) missense probably damaging 1.00
R4796:Ogdh UTSW 11 6,290,570 (GRCm39) missense probably benign 0.01
R5333:Ogdh UTSW 11 6,302,126 (GRCm39) missense probably damaging 1.00
R5592:Ogdh UTSW 11 6,266,763 (GRCm39) splice site probably null
R6318:Ogdh UTSW 11 6,299,390 (GRCm39) missense probably damaging 0.99
R6875:Ogdh UTSW 11 6,290,477 (GRCm39) missense probably benign 0.12
R6988:Ogdh UTSW 11 6,263,806 (GRCm39) nonsense probably null
R7406:Ogdh UTSW 11 6,298,351 (GRCm39) missense probably benign 0.00
R7763:Ogdh UTSW 11 6,288,558 (GRCm39) missense probably benign
R7909:Ogdh UTSW 11 6,263,965 (GRCm39) missense possibly damaging 0.55
R8207:Ogdh UTSW 11 6,299,329 (GRCm39) missense probably benign 0.38
R8348:Ogdh UTSW 11 6,292,619 (GRCm39) missense probably damaging 0.98
R8401:Ogdh UTSW 11 6,247,174 (GRCm39) nonsense probably null
R8448:Ogdh UTSW 11 6,292,619 (GRCm39) missense probably damaging 0.98
R8770:Ogdh UTSW 11 6,305,336 (GRCm39) missense probably damaging 1.00
R8796:Ogdh UTSW 11 6,297,129 (GRCm39) missense possibly damaging 0.75
R9132:Ogdh UTSW 11 6,290,488 (GRCm39) missense probably benign 0.01
R9328:Ogdh UTSW 11 6,297,838 (GRCm39) missense probably benign 0.30
R9479:Ogdh UTSW 11 6,297,854 (GRCm39) missense possibly damaging 0.89
R9696:Ogdh UTSW 11 6,289,209 (GRCm39) missense probably damaging 1.00
Z1088:Ogdh UTSW 11 6,305,427 (GRCm39) missense probably benign
Z1177:Ogdh UTSW 11 6,266,982 (GRCm39) missense probably benign 0.07
Z1177:Ogdh UTSW 11 6,247,051 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTTGAACCCCTGATCAC -3'
(R):5'- GGTCACAGCTCTACTTGTTGG -3'

Sequencing Primer
(F):5'- AAAACCCATCCTTGTATCTGTGTGTG -3'
(R):5'- CACAGCTCTACTTGTTGGTTAATAAC -3'
Posted On 2019-11-12