Incidental Mutation 'R0242:Thegl'
ID59541
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
MMRRC Submission 038480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0242 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 77016305 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 52 (E52*)
Ref Sequence ENSEMBL: ENSMUSP00000112814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably null
Transcript: ENSMUST00000031161
AA Change: E52*
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248
AA Change: E52*

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117880
AA Change: E52*
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248
AA Change: E52*

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129353
Meta Mutation Damage Score 0.9579 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 probably benign Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 F480L probably benign Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 T1324M probably benign Het
Dlgap2 A G 8: 14,727,562 D268G probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hc A G 2: 35,036,154 probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Myo5b A G 18: 74,661,716 H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 A451T possibly damaging Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
R8534:Thegl UTSW 5 77059478 missense probably damaging 1.00
R8899:Thegl UTSW 5 77037353 critical splice donor site probably null
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCGTCACGTCTCCATAGCAAC -3'
(R):5'- TGAAGGGGATCACTGCCCATTAGG -3'

Sequencing Primer
(F):5'- ggagctgaggctgtccc -3'
(R):5'- AAGGAATCACTGGTCTTGCG -3'
Posted On2013-07-11