Incidental Mutation 'R7725:Cercam'
ID595428
Institutional Source Beutler Lab
Gene Symbol Cercam
Ensembl Gene ENSMUSG00000039787
Gene Namecerebral endothelial cell adhesion molecule
SynonymsCeecam1, CerCAM
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29869164-29882840 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 29872562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047521] [ENSMUST00000134152] [ENSMUST00000154464]
Predicted Effect probably null
Transcript: ENSMUST00000047521
SMART Domains Protein: ENSMUSP00000041622
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 37 157 2.6e-15 PFAM
Pfam:Glyco_transf_25 316 500 3.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134152
SMART Domains Protein: ENSMUSP00000115902
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154464
SMART Domains Protein: ENSMUSP00000119476
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Cercam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Cercam APN 2 29881003 missense probably damaging 1.00
IGL02619:Cercam APN 2 29880674 missense probably benign 0.05
IGL03088:Cercam APN 2 29881687 splice site probably benign
I1329:Cercam UTSW 2 29871085 missense probably damaging 1.00
P0042:Cercam UTSW 2 29881083 missense probably damaging 1.00
R0086:Cercam UTSW 2 29871064 missense probably damaging 1.00
R0829:Cercam UTSW 2 29871067 missense probably damaging 0.98
R1442:Cercam UTSW 2 29880640 missense probably benign
R1558:Cercam UTSW 2 29876239 missense probably benign 0.35
R1997:Cercam UTSW 2 29872923 missense probably benign 0.11
R4678:Cercam UTSW 2 29869677 missense probably damaging 1.00
R4889:Cercam UTSW 2 29881833 missense probably damaging 0.96
R4891:Cercam UTSW 2 29869271 unclassified probably benign
R4967:Cercam UTSW 2 29871021 critical splice acceptor site probably null
R5052:Cercam UTSW 2 29875627 missense probably damaging 1.00
R5541:Cercam UTSW 2 29875629 missense probably benign
R5650:Cercam UTSW 2 29881815 missense probably damaging 1.00
R7072:Cercam UTSW 2 29881924 missense probably benign 0.00
R7422:Cercam UTSW 2 29872880 missense possibly damaging 0.81
R7585:Cercam UTSW 2 29881731 missense probably damaging 1.00
R7730:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7747:Cercam UTSW 2 29871286 missense probably benign 0.02
RF016:Cercam UTSW 2 29869305 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAATGGTTAGCCCCTTCTC -3'
(R):5'- GCCTTGAAGCCTCAGGATCTATC -3'

Sequencing Primer
(F):5'- TAAGTGCACATGCCATGGTATG -3'
(R):5'- GGATCTATCCTCCCCCTGGG -3'
Posted On2019-11-12