Incidental Mutation 'R7725:Olfr1101'
ID595430
Institutional Source Beutler Lab
Gene Symbol Olfr1101
Ensembl Gene ENSMUSG00000075167
Gene Nameolfactory receptor 1101
SynonymsGA_x6K02T2Q125-48475870-48474938, MOR179-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86986291-86991221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86988979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 66 (I66V)
Ref Sequence ENSEMBL: ENSMUSP00000151171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099870] [ENSMUST00000214411]
Predicted Effect probably benign
Transcript: ENSMUST00000099870
AA Change: I66V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097455
Gene: ENSMUSG00000075167
AA Change: I66V

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-51 PFAM
Pfam:7tm_1 38 287 5.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214411
AA Change: I66V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Olfr1101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr1101 APN 2 86988254 missense probably benign
IGL03018:Olfr1101 APN 2 86989005 missense probably damaging 1.00
IGL03265:Olfr1101 APN 2 86989080 missense probably damaging 1.00
R0627:Olfr1101 UTSW 2 86989014 missense probably benign 0.21
R2871:Olfr1101 UTSW 2 86988848 nonsense probably null
R2871:Olfr1101 UTSW 2 86988848 nonsense probably null
R7012:Olfr1101 UTSW 2 86988707 missense possibly damaging 0.50
R7144:Olfr1101 UTSW 2 86988820 missense probably damaging 1.00
R7151:Olfr1101 UTSW 2 86989041 missense probably benign 0.16
R7521:Olfr1101 UTSW 2 86988610 missense probably damaging 1.00
R7672:Olfr1101 UTSW 2 86988319 missense possibly damaging 0.93
R7863:Olfr1101 UTSW 2 86989080 missense probably damaging 1.00
R7946:Olfr1101 UTSW 2 86989080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTAGACTCTGGGTGACATG -3'
(R):5'- GTCTCTTTTCATCCTGAGGGGC -3'

Sequencing Primer
(F):5'- TACAGAAGTGGGTTGTAAATAGCTAC -3'
(R):5'- GGCCTCACAGACAATGCTG -3'
Posted On2019-11-12