Incidental Mutation 'R7725:Dennd4c'
ID595434
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86786093 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 282 (R282C)
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045512
AA Change: R282C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: R282C

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082026
AA Change: R282C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: R282C

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142837
AA Change: R282C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: R282C

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
Predicted Primers PCR Primer
(F):5'- CCTAAGATGCTTGGGGCTTG -3'
(R):5'- CACTTGATTCCATAGCCATGACTC -3'

Sequencing Primer
(F):5'- CTTGGGGTTTAATATCCAGCATG -3'
(R):5'- ACTTTTCAATGGGAAGAGGATGTG -3'
Posted On2019-11-12