Incidental Mutation 'R7725:Txk'
ID595436
Institutional Source Beutler Lab
Gene Symbol Txk
Ensembl Gene ENSMUSG00000054892
Gene NameTXK tyrosine kinase
SynonymsA130089B16Rik, PTK4, Btkl, Rlk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7725 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location72695978-72752777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72707557 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 379 (A379V)
Ref Sequence ENSEMBL: ENSMUSP00000109234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113604] [ENSMUST00000169534] [ENSMUST00000197313] [ENSMUST00000198464]
Predicted Effect probably damaging
Transcript: ENSMUST00000113604
AA Change: A379V

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109234
Gene: ENSMUSG00000054892
AA Change: A379V

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169534
AA Change: A379V

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129397
Gene: ENSMUSG00000054892
AA Change: A379V

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197313
AA Change: A357V

PolyPhen 2 Score 0.404 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143476
Gene: ENSMUSG00000054892
AA Change: A357V

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 138 1.2e-9 SMART
SH2 126 215 3.1e-35 SMART
TyrKc 249 498 1.2e-136 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198464
AA Change: A325V

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143002
Gene: ENSMUSG00000054892
AA Change: A325V

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
SH3 31 87 6.3e-19 SMART
SH2 94 183 5.4e-36 SMART
TyrKc 217 466 1.2e-136 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to parasitic (Toxoplasma gondii) infection and decreased cytokine secretion in stimulated splenocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Glb1l3 T A 9: 26,828,363 probably null Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Txk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Txk APN 5 72707546 missense possibly damaging 0.94
IGL02602:Txk APN 5 72707720 missense possibly damaging 0.89
IGL03353:Txk APN 5 72736402 missense probably benign
BB007:Txk UTSW 5 72735193 missense probably damaging 1.00
BB017:Txk UTSW 5 72735193 missense probably damaging 1.00
R0402:Txk UTSW 5 72731762 critical splice donor site probably null
R1509:Txk UTSW 5 72699110 missense probably damaging 1.00
R1511:Txk UTSW 5 72707671 missense probably damaging 1.00
R1785:Txk UTSW 5 72696579 missense probably damaging 1.00
R1786:Txk UTSW 5 72696579 missense probably damaging 1.00
R2131:Txk UTSW 5 72696579 missense probably damaging 1.00
R2913:Txk UTSW 5 72724451 missense probably damaging 1.00
R2914:Txk UTSW 5 72724451 missense probably damaging 1.00
R3722:Txk UTSW 5 72707735 nonsense probably null
R4080:Txk UTSW 5 72700663 missense probably damaging 1.00
R5341:Txk UTSW 5 72696621 missense probably benign 0.08
R5580:Txk UTSW 5 72707589 missense probably damaging 1.00
R6155:Txk UTSW 5 72700726 missense probably damaging 1.00
R6310:Txk UTSW 5 72736417 missense probably benign 0.01
R6382:Txk UTSW 5 72736480 intron probably benign
R6938:Txk UTSW 5 72699149 missense probably damaging 0.99
R7225:Txk UTSW 5 72700714 missense probably damaging 1.00
R7327:Txk UTSW 5 72715883 missense probably damaging 0.98
R7337:Txk UTSW 5 72731766 nonsense probably null
R7436:Txk UTSW 5 72696579 missense probably damaging 1.00
R7510:Txk UTSW 5 72736383 missense unknown
R7709:Txk UTSW 5 72707575 missense probably damaging 1.00
R7930:Txk UTSW 5 72735193 missense probably damaging 1.00
R8124:Txk UTSW 5 72703263 splice site probably null
R8531:Txk UTSW 5 72736377 missense possibly damaging 0.73
R8754:Txk UTSW 5 72731779 missense probably damaging 1.00
Z1176:Txk UTSW 5 72735211 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCAGGGCCTTGGCTTAAAC -3'
(R):5'- AACTGTCACATTCGAGGTTAGTTC -3'

Sequencing Primer
(F):5'- TTGGCTTAAACCACCAGCATTG -3'
(R):5'- CATTCGAGGTTAGTTCAACTTTACGG -3'
Posted On2019-11-12