Incidental Mutation 'R7725:Clip2'
ID595440
Institutional Source Beutler Lab
Gene Symbol Clip2
Ensembl Gene ENSMUSG00000063146
Gene NameCAP-GLY domain containing linker protein 2
SynonymsWSCR4, Cyln2, CLIP-115
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location134489383-134552434 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 134517999 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 238 (Y238*)
Ref Sequence ENSEMBL: ENSMUSP00000098212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]
Predicted Effect probably null
Transcript: ENSMUST00000036999
AA Change: Y238*
SMART Domains Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: Y238*

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 457 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
coiled coil region 529 578 N/A INTRINSIC
coiled coil region 640 982 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100647
AA Change: Y238*
SMART Domains Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: Y238*

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 496 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
coiled coil region 564 613 N/A INTRINSIC
coiled coil region 675 1017 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Clip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Clip2 APN 5 134500157 splice site probably benign
IGL01024:Clip2 APN 5 134510212 missense probably damaging 1.00
IGL01103:Clip2 APN 5 134492350 missense possibly damaging 0.64
IGL01726:Clip2 APN 5 134522664 missense probably damaging 1.00
IGL01833:Clip2 APN 5 134498084 splice site probably benign
IGL02174:Clip2 APN 5 134494264 missense probably damaging 1.00
IGL02232:Clip2 APN 5 134503130 missense probably damaging 1.00
IGL02271:Clip2 APN 5 134502571 missense probably benign 0.35
IGL02471:Clip2 APN 5 134518022 missense probably benign 0.04
IGL02690:Clip2 APN 5 134510159 splice site probably benign
IGL03198:Clip2 APN 5 134498082 splice site probably benign
IGL03269:Clip2 APN 5 134516894 missense probably damaging 1.00
R0335:Clip2 UTSW 5 134535215 start gained probably benign
R0422:Clip2 UTSW 5 134498113 missense probably benign 0.04
R0519:Clip2 UTSW 5 134516151 missense probably benign 0.01
R1169:Clip2 UTSW 5 134492250 missense probably benign 0.36
R1642:Clip2 UTSW 5 134503253 missense possibly damaging 0.89
R1718:Clip2 UTSW 5 134502929 nonsense probably null
R1822:Clip2 UTSW 5 134503227 missense probably benign 0.01
R1824:Clip2 UTSW 5 134503227 missense probably benign 0.01
R2011:Clip2 UTSW 5 134503115 missense probably damaging 1.00
R3106:Clip2 UTSW 5 134523064 missense probably benign 0.12
R3890:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3891:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3892:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R4134:Clip2 UTSW 5 134492253 missense probably benign 0.08
R4237:Clip2 UTSW 5 134535197 start gained probably benign
R4239:Clip2 UTSW 5 134535197 start gained probably benign
R4294:Clip2 UTSW 5 134492313 missense probably benign 0.09
R4450:Clip2 UTSW 5 134502953 missense possibly damaging 0.82
R4741:Clip2 UTSW 5 134516269 missense probably benign 0.02
R5186:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5235:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5409:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5410:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5448:Clip2 UTSW 5 134514048 missense probably benign 0.01
R5900:Clip2 UTSW 5 134502779 missense possibly damaging 0.48
R6464:Clip2 UTSW 5 134491925 missense probably benign 0.00
R7032:Clip2 UTSW 5 134522630 missense probably damaging 1.00
R7152:Clip2 UTSW 5 134496241 missense probably damaging 1.00
R7216:Clip2 UTSW 5 134502917 missense probably benign 0.01
R7358:Clip2 UTSW 5 134502630 nonsense probably null
X0062:Clip2 UTSW 5 134503136 missense probably benign 0.12
Z1177:Clip2 UTSW 5 134516835
Z1177:Clip2 UTSW 5 134522999
Predicted Primers PCR Primer
(F):5'- ACGTCATGGTGTCTGGTACAAC -3'
(R):5'- ATCATGCAGATGCTACATCCATAC -3'

Sequencing Primer
(F):5'- TACAACGTGCCCAGGGTTTC -3'
(R):5'- AACTTCCAGCACAGTTTGGG -3'
Posted On2019-11-12