Incidental Mutation 'R7725:Lmntd1'
ID595443
Institutional Source Beutler Lab
Gene Symbol Lmntd1
Ensembl Gene ENSMUSG00000054966
Gene Namelamin tail domain containing 1
SynonymsIfltd1, 4933403M22Rik, Lmna-rs1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location145365134-145614319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145543470 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 22 (S22P)
Ref Sequence ENSEMBL: ENSMUSP00000120740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148739]
Predicted Effect probably benign
Transcript: ENSMUST00000148739
AA Change: S22P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120740
Gene: ENSMUSG00000054966
AA Change: S22P

DomainStartEndE-ValueType
Pfam:LTD 24 144 1.2e-18 PFAM
low complexity region 228 244 N/A INTRINSIC
low complexity region 248 266 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Lmntd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lmntd1 APN 6 145433722 missense possibly damaging 0.92
IGL01986:Lmntd1 APN 6 145419807 missense probably damaging 1.00
IGL02064:Lmntd1 APN 6 145427276 splice site probably null
IGL02430:Lmntd1 APN 6 145413414 missense probably benign 0.34
IGL03296:Lmntd1 APN 6 145413477 missense probably benign 0.23
PIT4514001:Lmntd1 UTSW 6 145427253 frame shift probably null
R0022:Lmntd1 UTSW 6 145429990 missense probably benign 0.06
R0050:Lmntd1 UTSW 6 145417476 missense probably damaging 1.00
R0084:Lmntd1 UTSW 6 145404528 missense unknown
R0631:Lmntd1 UTSW 6 145430000 missense probably benign 0.00
R1716:Lmntd1 UTSW 6 145419874 missense probably damaging 1.00
R1850:Lmntd1 UTSW 6 145413480 missense probably benign 0.06
R3898:Lmntd1 UTSW 6 145413426 missense probably benign 0.16
R4411:Lmntd1 UTSW 6 145427277 critical splice donor site probably null
R5596:Lmntd1 UTSW 6 145413414 missense probably benign 0.34
R5944:Lmntd1 UTSW 6 145427316 missense probably damaging 0.99
R6711:Lmntd1 UTSW 6 145543502 missense probably benign 0.04
R7369:Lmntd1 UTSW 6 145413575 missense probably damaging 1.00
R7445:Lmntd1 UTSW 6 145429967 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAACCCAGATGAGTGGCTG -3'
(R):5'- GGTCCATCCTGTTCTGTAGAG -3'

Sequencing Primer
(F):5'- TTGAGCTGTTCTACTAAGTTTCTTCG -3'
(R):5'- AGAGGCTCTGTGTTCTCAGCTC -3'
Posted On2019-11-12