Incidental Mutation 'R7725:Htra4'
ID 595446
Institutional Source Beutler Lab
Gene Symbol Htra4
Ensembl Gene ENSMUSG00000037406
Gene Name HtrA serine peptidase 4
Synonyms B430206E18Rik
MMRRC Submission 045781-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7725 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 25514945-25528978 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25527169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 209 (S209P)
Ref Sequence ENSEMBL: ENSMUSP00000081044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064883] [ENSMUST00000084031] [ENSMUST00000128715]
AlphaFold A2RT60
Predicted Effect probably benign
Transcript: ENSMUST00000064883
SMART Domains Protein: ENSMUSP00000066546
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084031
AA Change: S209P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406
AA Change: S209P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128715
SMART Domains Protein: ENSMUSP00000122564
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa2 A T 9: 69,387,410 (GRCm39) K6N unknown Het
Arhgap20 T A 9: 51,743,050 (GRCm39) M296K possibly damaging Het
Bdh1 G A 16: 31,256,910 (GRCm39) V20I not run Het
Bop1 A G 15: 76,339,583 (GRCm39) I254T probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cct4 A G 11: 22,940,814 (GRCm39) K21E probably benign Het
Cercam G A 2: 29,762,574 (GRCm39) probably null Het
Clip2 A T 5: 134,546,853 (GRCm39) Y238* probably null Het
Col19a1 A T 1: 24,309,525 (GRCm39) S1043T possibly damaging Het
Ctcf A G 8: 106,390,468 (GRCm39) Y25C probably damaging Het
Dennd4c C T 4: 86,704,330 (GRCm39) R282C probably benign Het
Eef1g T A 19: 8,955,427 (GRCm39) H425Q probably benign Het
Fam131b C T 6: 42,295,476 (GRCm39) A234T probably benign Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam187b A G 7: 30,677,139 (GRCm39) D216G possibly damaging Het
Gabra1 A T 11: 42,026,270 (GRCm39) Y341N possibly damaging Het
Glb1l3 T A 9: 26,739,659 (GRCm39) probably null Het
Gm3667 T A 14: 18,271,599 (GRCm39) Q52L probably damaging Het
Gpr179 C T 11: 97,242,118 (GRCm39) R242H probably damaging Het
Gulo T C 14: 66,245,522 (GRCm39) Y24C probably damaging Het
Hectd4 A T 5: 121,358,680 (GRCm39) E49V unknown Het
Lmntd1 A G 6: 145,489,196 (GRCm39) S22P probably benign Het
Lypd8l A T 11: 58,499,325 (GRCm39) N164K probably benign Het
Med12l A G 3: 59,163,413 (GRCm39) K1347E probably damaging Het
Mrc1 C A 2: 14,284,788 (GRCm39) D592E probably benign Het
Muc15 A G 2: 110,562,143 (GRCm39) D193G probably damaging Het
Ncor2 A G 5: 125,100,630 (GRCm39) V1316A Het
Odad1 T A 7: 45,597,835 (GRCm39) S582T probably damaging Het
Or2t43 A G 11: 58,457,593 (GRCm39) Y193H probably damaging Het
Or2y10 A T 11: 49,455,359 (GRCm39) I204L probably benign Het
Or5t16 T C 2: 86,819,323 (GRCm39) I66V probably benign Het
Serpina6 A T 12: 103,614,936 (GRCm39) Y303* probably null Het
Shld2 T G 14: 33,990,661 (GRCm39) T82P possibly damaging Het
Shroom3 T C 5: 93,089,512 (GRCm39) L754P probably benign Het
Skint5 C A 4: 113,685,099 (GRCm39) L539F unknown Het
St3gal4 C A 9: 34,964,375 (GRCm39) R209L possibly damaging Het
Tex14 A C 11: 87,385,868 (GRCm39) T243P probably damaging Het
Ttc12 T A 9: 49,351,602 (GRCm39) M632L probably benign Het
Ttn T C 2: 76,738,116 (GRCm39) E4187G unknown Het
Txk G A 5: 72,864,900 (GRCm39) A379V probably damaging Het
Wdr43 A G 17: 71,923,338 (GRCm39) Y28C probably benign Het
Zfp1005 A G 2: 150,110,468 (GRCm39) Y386C unknown Het
Zfp40 A G 17: 23,397,251 (GRCm39) V82A probably benign Het
Zfp994 A T 17: 22,419,091 (GRCm39) N619K probably benign Het
Other mutations in Htra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Htra4 APN 8 25,523,587 (GRCm39) missense probably damaging 0.98
IGL01738:Htra4 APN 8 25,515,727 (GRCm39) missense probably damaging 0.96
IGL02307:Htra4 APN 8 25,523,710 (GRCm39) missense probably damaging 1.00
IGL03382:Htra4 APN 8 25,519,714 (GRCm39) missense probably benign 0.17
R0057:Htra4 UTSW 8 25,528,824 (GRCm39) missense probably benign
R0906:Htra4 UTSW 8 25,527,160 (GRCm39) missense probably benign 0.00
R1075:Htra4 UTSW 8 25,523,612 (GRCm39) missense probably benign 0.00
R1173:Htra4 UTSW 8 25,520,635 (GRCm39) missense possibly damaging 0.92
R1180:Htra4 UTSW 8 25,523,735 (GRCm39) missense probably damaging 1.00
R1854:Htra4 UTSW 8 25,523,597 (GRCm39) missense probably damaging 1.00
R2030:Htra4 UTSW 8 25,523,593 (GRCm39) missense probably damaging 1.00
R2225:Htra4 UTSW 8 25,515,736 (GRCm39) missense probably benign 0.42
R4457:Htra4 UTSW 8 25,528,674 (GRCm39) missense possibly damaging 0.90
R4626:Htra4 UTSW 8 25,527,130 (GRCm39) missense probably benign 0.29
R4746:Htra4 UTSW 8 25,523,713 (GRCm39) missense probably damaging 1.00
R4797:Htra4 UTSW 8 25,523,675 (GRCm39) missense probably damaging 1.00
R5369:Htra4 UTSW 8 25,523,585 (GRCm39) missense possibly damaging 0.95
R6846:Htra4 UTSW 8 25,520,561 (GRCm39) missense probably damaging 1.00
R6911:Htra4 UTSW 8 25,515,721 (GRCm39) missense probably damaging 0.96
R7067:Htra4 UTSW 8 25,523,717 (GRCm39) missense probably damaging 1.00
R7367:Htra4 UTSW 8 25,523,713 (GRCm39) missense probably damaging 1.00
R7446:Htra4 UTSW 8 25,527,181 (GRCm39) missense probably benign 0.09
R7603:Htra4 UTSW 8 25,515,716 (GRCm39) missense probably benign 0.03
R7729:Htra4 UTSW 8 25,527,093 (GRCm39) missense possibly damaging 0.63
R7893:Htra4 UTSW 8 25,523,695 (GRCm39) missense possibly damaging 0.81
R7988:Htra4 UTSW 8 25,520,526 (GRCm39) critical splice donor site probably null
R8140:Htra4 UTSW 8 25,520,574 (GRCm39) missense possibly damaging 0.75
R9169:Htra4 UTSW 8 25,520,133 (GRCm39) missense probably damaging 1.00
R9223:Htra4 UTSW 8 25,527,048 (GRCm39) missense possibly damaging 0.94
R9229:Htra4 UTSW 8 25,528,557 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAAGGCTCTGACTCAGC -3'
(R):5'- CTCACAAAGCACATGGAAGTGG -3'

Sequencing Primer
(F):5'- GACTCAGCAGCTCTCTCAGGTAC -3'
(R):5'- CACATGGAAGTGGGTAAGGC -3'
Posted On 2019-11-12