Incidental Mutation 'R7725:Ttc12'
ID595449
Institutional Source Beutler Lab
Gene Symbol Ttc12
Ensembl Gene ENSMUSG00000040219
Gene Nametetratricopeptide repeat domain 12
SynonymsE330017O07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location49436963-49486225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49440302 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 632 (M632L)
Ref Sequence ENSEMBL: ENSMUSP00000056378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055096]
Predicted Effect probably benign
Transcript: ENSMUST00000055096
AA Change: M632L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000056378
Gene: ENSMUSG00000040219
AA Change: M632L

DomainStartEndE-ValueType
coiled coil region 1 29 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
TPR 105 138 9.39e-1 SMART
TPR 139 172 1.97e-3 SMART
TPR 173 206 1.09e-5 SMART
low complexity region 356 368 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
Blast:ARM 634 675 1e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Ttc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Ttc12 APN 9 49471206 splice site probably null
IGL01300:Ttc12 APN 9 49447922 splice site probably benign
IGL02100:Ttc12 APN 9 49440182 missense probably damaging 1.00
IGL03106:Ttc12 APN 9 49458062 missense possibly damaging 0.75
I2288:Ttc12 UTSW 9 49470258 missense possibly damaging 0.62
R1238:Ttc12 UTSW 9 49458187 splice site probably benign
R1712:Ttc12 UTSW 9 49445199 missense probably benign
R1725:Ttc12 UTSW 9 49458115 missense probably benign 0.08
R1824:Ttc12 UTSW 9 49456884 missense probably damaging 1.00
R1916:Ttc12 UTSW 9 49460398 missense probably damaging 1.00
R2226:Ttc12 UTSW 9 49441835 critical splice donor site probably null
R4498:Ttc12 UTSW 9 49472405 missense probably damaging 1.00
R5920:Ttc12 UTSW 9 49453333 missense possibly damaging 0.48
R6020:Ttc12 UTSW 9 49443122 missense probably damaging 0.96
R6687:Ttc12 UTSW 9 49438418 missense probably benign 0.08
R6755:Ttc12 UTSW 9 49453346 missense probably benign 0.00
R6975:Ttc12 UTSW 9 49438418 missense probably benign 0.08
R7349:Ttc12 UTSW 9 49447967 missense possibly damaging 0.94
R7357:Ttc12 UTSW 9 49438387 missense probably benign 0.02
R7451:Ttc12 UTSW 9 49471879 missense probably benign 0.00
R7842:Ttc12 UTSW 9 49438424 missense possibly damaging 0.80
R7925:Ttc12 UTSW 9 49438424 missense possibly damaging 0.80
R8029:Ttc12 UTSW 9 49470251 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACAGTGCTTGGTTTGCCCTG -3'
(R):5'- TTCTGAAGAAGCTTGCCATCC -3'

Sequencing Primer
(F):5'- TCTGAGATGTTATCACCACTTGG -3'
(R):5'- AGCTTGCCATCCACCCCG -3'
Posted On2019-11-12