Incidental Mutation 'R7725:Anxa2'
ID595451
Institutional Source Beutler Lab
Gene Symbol Anxa2
Ensembl Gene ENSMUSG00000032231
Gene Nameannexin A2
Synonymslipocortin II, annexin II, Cal1h, 36-kDa calelectrin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location69453620-69491795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69480128 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 6 (K6N)
Ref Sequence ENSEMBL: ENSMUSP00000117855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034756] [ENSMUST00000123470] [ENSMUST00000134907] [ENSMUST00000136282]
Predicted Effect probably benign
Transcript: ENSMUST00000034756
SMART Domains Protein: ENSMUSP00000034756
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
ANX 207 259 8.2e-11 SMART
ANX 282 334 1.6e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123470
SMART Domains Protein: ENSMUSP00000122175
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134907
SMART Domains Protein: ENSMUSP00000117979
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000136282
AA Change: K6N
SMART Domains Protein: ENSMUSP00000117855
Gene: ENSMUSG00000032231
AA Change: K6N

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
ANX 55 107 1.5e-27 SMART
ANX 140 192 8.2e-11 SMART
ANX 215 267 1.6e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but suffer from growth deficits, impaired angiogenesis, and increased susceptibility to thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Anxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Anxa2 APN 9 69483019 nonsense probably null
IGL02550:Anxa2 APN 9 69467306 missense probably benign 0.00
FR4342:Anxa2 UTSW 9 69480205 small insertion probably benign
FR4342:Anxa2 UTSW 9 69480210 small insertion probably benign
FR4548:Anxa2 UTSW 9 69480203 small insertion probably benign
FR4589:Anxa2 UTSW 9 69480210 small insertion probably benign
R1480:Anxa2 UTSW 9 69489754 frame shift probably null
R1482:Anxa2 UTSW 9 69489754 frame shift probably null
R1519:Anxa2 UTSW 9 69485241 missense probably damaging 1.00
R1609:Anxa2 UTSW 9 69489754 frame shift probably null
R1610:Anxa2 UTSW 9 69489754 frame shift probably null
R1624:Anxa2 UTSW 9 69479708 missense probably benign 0.10
R1672:Anxa2 UTSW 9 69489754 frame shift probably null
R1696:Anxa2 UTSW 9 69489754 frame shift probably null
R1760:Anxa2 UTSW 9 69489767 missense probably benign 0.00
R1775:Anxa2 UTSW 9 69488081 missense possibly damaging 0.93
R1828:Anxa2 UTSW 9 69482978 missense probably damaging 1.00
R1884:Anxa2 UTSW 9 69489754 frame shift probably null
R1991:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2020:Anxa2 UTSW 9 69483817 missense probably damaging 0.99
R2029:Anxa2 UTSW 9 69464480 missense possibly damaging 0.71
R2103:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2129:Anxa2 UTSW 9 69476128 missense possibly damaging 0.48
R2146:Anxa2 UTSW 9 69489754 frame shift probably null
R2148:Anxa2 UTSW 9 69489754 frame shift probably null
R2149:Anxa2 UTSW 9 69489754 frame shift probably null
R2150:Anxa2 UTSW 9 69489754 frame shift probably null
R2437:Anxa2 UTSW 9 69489764 missense probably damaging 1.00
R3848:Anxa2 UTSW 9 69467342 missense probably damaging 1.00
R4036:Anxa2 UTSW 9 69488070 missense probably damaging 0.99
R4565:Anxa2 UTSW 9 69489737 missense probably damaging 1.00
R4731:Anxa2 UTSW 9 69486530 missense probably benign 0.41
R5172:Anxa2 UTSW 9 69485251 missense probably damaging 0.99
R5181:Anxa2 UTSW 9 69476065 missense probably benign 0.00
R6427:Anxa2 UTSW 9 69476149 critical splice donor site probably null
R6759:Anxa2 UTSW 9 69483821 missense probably damaging 1.00
R7734:Anxa2 UTSW 9 69491482 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCCCAATGCTATAAGTTGTCAGG -3'
(R):5'- AAACTTCCCATTGGATTCAGGTG -3'

Sequencing Primer
(F):5'- GCTATAAGTTGTCAGGATTTGAACC -3'
(R):5'- CCATTGGATTCAGGTGCCAGTC -3'
Posted On2019-11-12