Incidental Mutation 'R7725:Cct4'
List |< first << previous [record 8 of 44] next >> last >|
ID595453
Institutional Source Beutler Lab
Gene Symbol Cct4
Ensembl Gene ENSMUSG00000007739
Gene Namechaperonin containing Tcp1, subunit 4 (delta)
Synonyms2610204B21Rik, A45, T complex protein 1, delta, Cctd, TCP-1 delta
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location22990519-23003780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22990814 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 21 (K21E)
Ref Sequence ENSEMBL: ENSMUSP00000133523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020562] [ENSMUST00000173853] [ENSMUST00000173867] [ENSMUST00000174047] [ENSMUST00000174659]
Predicted Effect probably benign
Transcript: ENSMUST00000020562
AA Change: K21E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020562
Gene: ENSMUSG00000007739
AA Change: K21E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 61 509 1.6e-122 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173853
AA Change: K21E
SMART Domains Protein: ENSMUSP00000133677
Gene: ENSMUSG00000007739
AA Change: K21E

DomainStartEndE-ValueType
PDB:4B2T|D 1 44 2e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000173867
AA Change: K21E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133523
Gene: ENSMUSG00000007739
AA Change: K21E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 539 1.9e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174047
AA Change: K21E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134248
Gene: ENSMUSG00000007739
AA Change: K21E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 93 1.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174659
AA Change: K21E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The chaperonin containing TCP1 (MIM 186980) complex (CCT), also called the TCP1 ring complex, consists of 2 back-to-back rings, each containing 8 unique but homologous subunits, such as CCT4. CCT assists the folding of newly translated polypeptide substrates through multiple rounds of ATP-driven release and rebinding of partially folded intermediate forms. Substrates of CCT include the cytoskeletal proteins actin (see MIM 102560) and tubulin (see MIM 191130), as well as alpha-transducin (MIM 139330) (Won et al., 1998 [PubMed 9819444]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Cct4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cct4 APN 11 22997656 missense possibly damaging 0.63
IGL02076:Cct4 APN 11 23002394 missense probably damaging 1.00
IGL02211:Cct4 APN 11 22993327 intron probably benign
IGL02416:Cct4 APN 11 23002868 missense probably damaging 1.00
R0030:Cct4 UTSW 11 23001357 unclassified probably benign
R0255:Cct4 UTSW 11 22999073 missense probably damaging 1.00
R0494:Cct4 UTSW 11 22996014 missense probably benign
R1244:Cct4 UTSW 11 22996417 missense probably benign 0.02
R1276:Cct4 UTSW 11 23002171 missense probably damaging 1.00
R1401:Cct4 UTSW 11 22994333 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1809:Cct4 UTSW 11 22997615 missense probably benign 0.00
R3907:Cct4 UTSW 11 23001560 missense probably benign 0.00
R4640:Cct4 UTSW 11 23002297 missense probably benign 0.04
R4785:Cct4 UTSW 11 23002866 missense probably damaging 1.00
R4836:Cct4 UTSW 11 23002898 missense probably benign 0.20
R5846:Cct4 UTSW 11 23001354 unclassified probably benign
R7193:Cct4 UTSW 11 22997111 missense probably benign 0.00
R7214:Cct4 UTSW 11 22990616 unclassified probably benign
R7336:Cct4 UTSW 11 23001564 missense possibly damaging 0.85
R7419:Cct4 UTSW 11 22996420 missense probably benign 0.01
R8003:Cct4 UTSW 11 22996040 critical splice donor site probably null
X0019:Cct4 UTSW 11 22997118 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CGTCGCTTTCTGGAAGGTTC -3'
(R):5'- CCTGCAGGAGACGAACTAAG -3'

Sequencing Primer
(F):5'- CTGGAAGGTTCGTGGAGGAG -3'
(R):5'- CTCCGAGTGCTTAGCAGAAAG -3'
Posted On2019-11-12