Incidental Mutation 'R7725:Gabra1'
ID595454
Institutional Source Beutler Lab
Gene Symbol Gabra1
Ensembl Gene ENSMUSG00000010803
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 1
SynonymsGabra-1, GABAAR alpha1, GABAA alpha 1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location42130939-42182930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42135443 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 341 (Y341N)
Ref Sequence ENSEMBL: ENSMUSP00000020707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020707] [ENSMUST00000205546] [ENSMUST00000206105]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020707
AA Change: Y341N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020707
Gene: ENSMUSG00000010803
AA Change: Y341N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 41 249 1.5e-52 PFAM
Pfam:Neur_chan_memb 256 347 8.6e-33 PFAM
low complexity region 395 411 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205546
AA Change: Y341N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206105
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knockout alleles or ones with various nucleotide substitutions exhibit altered life span, abnormal response to benzodiazepines and imidazopyridines, abnormal behaviors and abnormal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Gabra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Gabra1 APN 11 42133626 missense probably benign 0.06
IGL01645:Gabra1 APN 11 42135562 missense probably damaging 1.00
IGL01893:Gabra1 APN 11 42133759 missense possibly damaging 0.80
IGL02114:Gabra1 APN 11 42135575 missense probably damaging 1.00
IGL02378:Gabra1 APN 11 42140255 missense probably damaging 1.00
IGL03402:Gabra1 APN 11 42133518 missense probably damaging 0.96
R0546:Gabra1 UTSW 11 42162601 missense probably damaging 0.96
R1495:Gabra1 UTSW 11 42154944 missense probably damaging 1.00
R1538:Gabra1 UTSW 11 42140350 missense probably benign 0.19
R1850:Gabra1 UTSW 11 42179576 missense probably benign
R1989:Gabra1 UTSW 11 42155015 missense probably damaging 1.00
R2061:Gabra1 UTSW 11 42133798 unclassified probably benign
R3758:Gabra1 UTSW 11 42175936 missense probably benign 0.25
R4781:Gabra1 UTSW 11 42133661 missense probably damaging 0.98
R4788:Gabra1 UTSW 11 42147153 missense probably damaging 1.00
R5215:Gabra1 UTSW 11 42154828 missense probably damaging 1.00
R5306:Gabra1 UTSW 11 42133552 missense probably benign 0.00
R5655:Gabra1 UTSW 11 42182923 unclassified probably null
R5789:Gabra1 UTSW 11 42182915 unclassified probably benign
R6273:Gabra1 UTSW 11 42140311 missense probably damaging 0.99
R6289:Gabra1 UTSW 11 42155019 missense probably damaging 0.97
R6298:Gabra1 UTSW 11 42182378 unclassified probably benign
R6475:Gabra1 UTSW 11 42162555 missense probably benign 0.08
R6552:Gabra1 UTSW 11 42147099 missense probably damaging 0.99
R7338:Gabra1 UTSW 11 42182294 missense unknown
R7405:Gabra1 UTSW 11 42155023 missense probably damaging 1.00
R7515:Gabra1 UTSW 11 42154833 missense possibly damaging 0.95
R7727:Gabra1 UTSW 11 42133591 missense probably damaging 1.00
X0066:Gabra1 UTSW 11 42133738 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTACCCAAACAACCTCTGCTATG -3'
(R):5'- TTAGGAGTGACGACTGTTCTGAC -3'

Sequencing Primer
(F):5'- ACCCACTGTTACTTTATCATTCACAG -3'
(R):5'- CTATGACAACCTTGAGTATCAGTGCC -3'
Posted On2019-11-12