Incidental Mutation 'R7725:Olfr1380'
List |< first << previous [record 32 of 44] next >> last >|
ID595455
Institutional Source Beutler Lab
Gene Symbol Olfr1380
Ensembl Gene ENSMUSG00000107645
Gene Nameolfactory receptor 1380
SynonymsMOR256-66_i, GA_x6K02T2QP88-5871967-5871032
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49556878-49565859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49564532 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 204 (I204L)
Ref Sequence ENSEMBL: ENSMUSP00000151039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204300] [ENSMUST00000215360]
Predicted Effect probably benign
Transcript: ENSMUST00000204300
AA Change: I204L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000145428
Gene: ENSMUSG00000107645
AA Change: I204L

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.4e-47 PFAM
Pfam:7tm_1 41 289 9.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215360
AA Change: I204L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Olfr1380
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr1380 APN 11 49563920 utr 5 prime probably benign
IGL01354:Olfr1380 APN 11 49564197 missense probably damaging 0.99
R0183:Olfr1380 UTSW 11 49564848 missense probably benign 0.14
R0849:Olfr1380 UTSW 11 49564302 missense probably damaging 0.99
R3855:Olfr1380 UTSW 11 49564091 missense probably damaging 0.98
R3904:Olfr1380 UTSW 11 49564758 missense possibly damaging 0.50
R4598:Olfr1380 UTSW 11 49564718 missense probably damaging 1.00
R4599:Olfr1380 UTSW 11 49564718 missense probably damaging 1.00
R5089:Olfr1380 UTSW 11 49564413 missense possibly damaging 0.94
R6029:Olfr1380 UTSW 11 49564601 missense possibly damaging 0.94
R6551:Olfr1380 UTSW 11 49563989 missense probably benign
R6953:Olfr1380 UTSW 11 49564290 missense probably damaging 1.00
R7223:Olfr1380 UTSW 11 49564098 missense probably damaging 0.99
R7343:Olfr1380 UTSW 11 49564502 missense possibly damaging 0.91
R7762:Olfr1380 UTSW 11 49564761 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATGCACCCTGTTCTCTGCAG -3'
(R):5'- TCCTTCTCAGAATACCTGTGGAC -3'

Sequencing Primer
(F):5'- CCTGTTCTCTGCAGAGCATTGG -3'
(R):5'- ACAGGTTGGAGGTATGTGGAGATG -3'
Posted On2019-11-12