Incidental Mutation 'R7725:Tex14'
ID595458
Institutional Source Beutler Lab
Gene Symbol Tex14
Ensembl Gene ENSMUSG00000010342
Gene Nametestis expressed gene 14
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87405065-87555823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87495042 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 243 (T243P)
Ref Sequence ENSEMBL: ENSMUSP00000054444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060835]
Predicted Effect probably damaging
Transcript: ENSMUST00000060835
AA Change: T243P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342
AA Change: T243P

DomainStartEndE-ValueType
ANK 22 51 7.99e2 SMART
ANK 55 84 6.36e-3 SMART
ANK 88 117 3.49e0 SMART
Pfam:Pkinase 251 504 3.5e-19 PFAM
Pfam:Pkinase_Tyr 254 503 8.1e-28 PFAM
coiled coil region 659 684 N/A INTRINSIC
coiled coil region 740 776 N/A INTRINSIC
low complexity region 1219 1236 N/A INTRINSIC
coiled coil region 1289 1309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Tex14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tex14 APN 11 87535643 missense probably damaging 0.98
IGL00494:Tex14 APN 11 87555484 missense probably damaging 1.00
IGL01604:Tex14 APN 11 87509698 missense possibly damaging 0.63
IGL02690:Tex14 APN 11 87486274 missense probably benign 0.11
IGL02888:Tex14 APN 11 87527912 critical splice donor site probably null
IGL03073:Tex14 APN 11 87535609 missense probably damaging 0.99
IGL03109:Tex14 APN 11 87543365 missense probably damaging 1.00
IGL03047:Tex14 UTSW 11 87536704 missense probably damaging 1.00
R0141:Tex14 UTSW 11 87493031 splice site probably null
R0455:Tex14 UTSW 11 87514305 missense possibly damaging 0.93
R0624:Tex14 UTSW 11 87520699 missense probably benign 0.19
R0718:Tex14 UTSW 11 87499613 missense probably benign 0.20
R1077:Tex14 UTSW 11 87519745 splice site probably benign
R1118:Tex14 UTSW 11 87522517 missense probably benign 0.07
R1120:Tex14 UTSW 11 87538676 splice site probably benign
R1168:Tex14 UTSW 11 87536742 missense probably benign 0.11
R1190:Tex14 UTSW 11 87495108 intron probably null
R1470:Tex14 UTSW 11 87549529 splice site probably benign
R1563:Tex14 UTSW 11 87536808 missense probably damaging 0.99
R1607:Tex14 UTSW 11 87554928 missense probably damaging 1.00
R1696:Tex14 UTSW 11 87511545 missense possibly damaging 0.49
R1873:Tex14 UTSW 11 87499605 missense probably damaging 1.00
R1894:Tex14 UTSW 11 87474448 missense probably damaging 1.00
R1911:Tex14 UTSW 11 87495035 missense probably damaging 1.00
R1955:Tex14 UTSW 11 87509621 missense probably damaging 1.00
R1971:Tex14 UTSW 11 87511605 missense probably damaging 1.00
R1990:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1991:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1993:Tex14 UTSW 11 87536755 missense possibly damaging 0.57
R2106:Tex14 UTSW 11 87486250 missense possibly damaging 0.47
R2118:Tex14 UTSW 11 87519743 splice site probably benign
R2860:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R2861:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R4016:Tex14 UTSW 11 87538623 unclassified probably null
R4089:Tex14 UTSW 11 87512203 missense probably damaging 1.00
R4158:Tex14 UTSW 11 87516769 missense probably benign 0.06
R4533:Tex14 UTSW 11 87536829 nonsense probably null
R4713:Tex14 UTSW 11 87536865 missense probably damaging 0.99
R4758:Tex14 UTSW 11 87514485 missense probably benign 0.00
R4880:Tex14 UTSW 11 87486295 missense possibly damaging 0.95
R4953:Tex14 UTSW 11 87536901 critical splice donor site probably null
R5092:Tex14 UTSW 11 87514842 missense probably benign 0.03
R5119:Tex14 UTSW 11 87433813 missense probably damaging 1.00
R5322:Tex14 UTSW 11 87511472 missense probably benign 0.04
R5470:Tex14 UTSW 11 87551604 missense probably damaging 0.99
R5607:Tex14 UTSW 11 87522578 missense probably benign 0.00
R5642:Tex14 UTSW 11 87514220 missense probably benign
R5643:Tex14 UTSW 11 87535626 missense probably damaging 1.00
R5786:Tex14 UTSW 11 87514295 missense probably damaging 0.97
R6478:Tex14 UTSW 11 87514373 missense probably benign
R6560:Tex14 UTSW 11 87497862 missense possibly damaging 0.95
R6661:Tex14 UTSW 11 87495016 missense probably damaging 1.00
R7037:Tex14 UTSW 11 87497915 missense probably damaging 1.00
R7156:Tex14 UTSW 11 87484719 missense probably damaging 0.99
R7465:Tex14 UTSW 11 87514430 missense possibly damaging 0.48
R7675:Tex14 UTSW 11 87509678 missense probably damaging 1.00
R7911:Tex14 UTSW 11 87533602 critical splice donor site probably null
R7992:Tex14 UTSW 11 87533602 critical splice donor site probably null
RF018:Tex14 UTSW 11 87514746 missense probably benign 0.01
X0017:Tex14 UTSW 11 87535549 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCAGCTCCAAGCCAAG -3'
(R):5'- TCAGTCCTGTCCCATCCAAGAAG -3'

Sequencing Primer
(F):5'- AGCTCCAAGCCAAGGCAGG -3'
(R):5'- CAGCCTGGTCTACAAAGTGAGTTC -3'
Posted On2019-11-12