Incidental Mutation 'R7725:Serpina6'
List |< first << previous [record 34 of 44] next >> last >|
ID595460
Institutional Source Beutler Lab
Gene Symbol Serpina6
Ensembl Gene ENSMUSG00000060807
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 6
SynonymsCbg
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location103646630-103657212 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 103648677 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 303 (Y303*)
Ref Sequence ENSEMBL: ENSMUSP00000044033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044159]
Predicted Effect probably null
Transcript: ENSMUST00000044159
AA Change: Y303*
SMART Domains Protein: ENSMUSP00000044033
Gene: ENSMUSG00000060807
AA Change: Y303*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 43 396 3.45e-160 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the serpin (serine protease inhibitor) family. The encoded protein is an alpha-globulin with corticosteroid-binding properties. This is the major transport protein for glucorticoids and progestins in the blood of most vertebrates. The gene localizes to a chromosomal region containing several closely related serine protease inhibitors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null homozygotes exhibit reduced total plasma corticosterone, increased susceptibility to bacterial infection, attenuation of the stress-induced surge in free corticosterone, and enhanced behavioral response to intense or uncontrollable stress. They exhibit no locomotor sensitization to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Serpina6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Serpina6 APN 12 103651903 missense probably damaging 1.00
IGL00910:Serpina6 APN 12 103651965 unclassified probably benign
IGL01512:Serpina6 APN 12 103654059 missense probably damaging 0.96
IGL02994:Serpina6 APN 12 103653951 missense probably benign 0.03
IGL03092:Serpina6 APN 12 103653895 critical splice donor site probably null
IGL03351:Serpina6 APN 12 103646913 missense probably damaging 1.00
R0178:Serpina6 UTSW 12 103646913 missense probably damaging 0.98
R0362:Serpina6 UTSW 12 103651949 missense probably damaging 0.98
R0530:Serpina6 UTSW 12 103651794 missense probably damaging 1.00
R1542:Serpina6 UTSW 12 103654473 missense probably benign 0.09
R1573:Serpina6 UTSW 12 103651753 missense probably damaging 1.00
R1764:Serpina6 UTSW 12 103653923 missense probably damaging 1.00
R2243:Serpina6 UTSW 12 103646928 missense probably benign 0.00
R2309:Serpina6 UTSW 12 103654179 missense probably benign 0.00
R2363:Serpina6 UTSW 12 103648609 missense probably benign 0.00
R3691:Serpina6 UTSW 12 103654409 missense probably benign 0.00
R4492:Serpina6 UTSW 12 103646887 missense probably damaging 1.00
R4498:Serpina6 UTSW 12 103654067 missense probably benign 0.02
R4953:Serpina6 UTSW 12 103651962 critical splice acceptor site probably null
R4985:Serpina6 UTSW 12 103653936 missense probably benign 0.00
R5022:Serpina6 UTSW 12 103651712 missense probably damaging 1.00
R5230:Serpina6 UTSW 12 103651898 missense probably benign 0.18
R5318:Serpina6 UTSW 12 103653962 missense possibly damaging 0.68
R5350:Serpina6 UTSW 12 103648579 missense possibly damaging 0.68
R5569:Serpina6 UTSW 12 103654460 missense possibly damaging 0.90
R5664:Serpina6 UTSW 12 103654467 missense probably damaging 0.97
R5882:Serpina6 UTSW 12 103654235 missense probably benign 0.00
R6275:Serpina6 UTSW 12 103648720 missense probably benign 0.01
R6364:Serpina6 UTSW 12 103654236 missense probably benign
R7173:Serpina6 UTSW 12 103646994 missense possibly damaging 0.78
R7181:Serpina6 UTSW 12 103646944 missense probably benign 0.00
R7811:Serpina6 UTSW 12 103654136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACCTATGGGACCTTTAAC -3'
(R):5'- TCTTGAAAGGGATCATCCAGGG -3'

Sequencing Primer
(F):5'- CCTATGGGACCTTTAACAAATGGG -3'
(R):5'- CCTGTATCCCTAATGAGTGAGTCAG -3'
Posted On2019-11-12