Incidental Mutation 'R7725:Gm3667'
List |< first << previous [record 21 of 44] next >> last >|
ID595461
Institutional Source Beutler Lab
Gene Symbol Gm3667
Ensembl Gene ENSMUSG00000090691
Gene Namepredicted gene 3667
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7725 (G1)
Quality Score116.008
Status Not validated
Chromosome14
Chromosomal Location6868502-6889962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6874268 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 52 (Q52L)
Ref Sequence ENSEMBL: ENSMUSP00000133107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171906]
Predicted Effect probably damaging
Transcript: ENSMUST00000171906
AA Change: Q52L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133107
Gene: ENSMUSG00000090691
AA Change: Q52L

DomainStartEndE-ValueType
Pfam:Takusan 46 129 4.5e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Gm3667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03032:Gm3667 APN 14 6872191 missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- TGGCACAATACAGTCAACAGGG -3'
(R):5'- GGCATATGTCTGACAATGGTGG -3'

Sequencing Primer
(F):5'- CAGGGTACTGGGCATAATTCCTAC -3'
(R):5'- TAGCTTAGCAAACCAGCTGG -3'
Posted On2019-11-12