Incidental Mutation 'R7725:Gulo'
List |< first << previous [record 23 of 44] next >> last >|
ID595463
Institutional Source Beutler Lab
Gene Symbol Gulo
Ensembl Gene ENSMUSG00000034450
Gene Namegulonolactone (L-) oxidase
SynonymsL-gulono-gamma-lactone oxidase, sfx
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65986786-66009207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66008073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 24 (Y24C)
Ref Sequence ENSEMBL: ENSMUSP00000060912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059970]
Predicted Effect probably damaging
Transcript: ENSMUST00000059970
AA Change: Y24C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060912
Gene: ENSMUSG00000034450
AA Change: Y24C

DomainStartEndE-ValueType
Pfam:FAD_binding_4 21 156 7.6e-36 PFAM
Pfam:ALO 180 438 2.8e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for spontaneous mutations exhibit impaired growth and mobility, decreased spleen and thymus weights, reduced serum calcium, phosphate, alkaline phosphatase, IGF1, and osteocalcin levels, and small, fragile and histologically abnormal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Gulo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gulo APN 14 66005949 missense probably damaging 1.00
IGL01736:Gulo APN 14 65996876 missense probably benign 0.24
R0599:Gulo UTSW 14 65990441 missense probably damaging 1.00
R2014:Gulo UTSW 14 66009047 start codon destroyed probably benign
R2058:Gulo UTSW 14 65991159 missense possibly damaging 0.51
R2079:Gulo UTSW 14 65990383 missense probably damaging 1.00
R2405:Gulo UTSW 14 65991028 critical splice donor site probably null
R4196:Gulo UTSW 14 65988253 missense possibly damaging 0.49
R4807:Gulo UTSW 14 65990384 missense probably benign 0.00
R5341:Gulo UTSW 14 65988258 missense probably benign 0.12
R5913:Gulo UTSW 14 66000021 critical splice acceptor site probably null
R5915:Gulo UTSW 14 66008121 missense probably benign 0.29
R6328:Gulo UTSW 14 66002631 missense probably damaging 1.00
R6628:Gulo UTSW 14 66004170 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTACAACAGGCTGCGG -3'
(R):5'- CCATAGTAGCCAAAGGGAGC -3'

Sequencing Primer
(F):5'- GAGCAGACCTGGAGCTGG -3'
(R):5'- GTGCTGTGGCCATGTCCTC -3'
Posted On2019-11-12