Incidental Mutation 'R7725:Bop1'
List [record 1 of 44] next >> last >|
ID595464
Institutional Source Beutler Lab
Gene Symbol Bop1
Ensembl Gene ENSMUSG00000022557
Gene Nameblock of proliferation 1
SynonymsErb1p
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76452989-76477277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76455383 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 254 (I254T)
Ref Sequence ENSEMBL: ENSMUSP00000023217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023217] [ENSMUST00000043089] [ENSMUST00000096385]
Predicted Effect probably benign
Transcript: ENSMUST00000023217
AA Change: I254T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023217
Gene: ENSMUSG00000022557
AA Change: I254T

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
BOP1NT 130 388 1.38e-177 SMART
WD40 388 427 1.16e-9 SMART
WD40 430 469 6.16e0 SMART
WD40 508 551 7.1e1 SMART
WD40 554 592 4.46e-1 SMART
WD40 595 634 2.76e-2 SMART
WD40 638 677 4.14e-6 SMART
WD40 689 732 3.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043089
SMART Domains Protein: ENSMUSP00000043668
Gene: ENSMUSG00000034161

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
low complexity region 45 80 N/A INTRINSIC
HLH 84 136 1.46e-16 SMART
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161265
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Bop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Bop1 APN 15 76454528 missense probably benign 0.04
IGL01085:Bop1 APN 15 76453376 missense probably damaging 1.00
IGL02157:Bop1 APN 15 76455572 missense possibly damaging 0.70
R0332:Bop1 UTSW 15 76455987 missense probably damaging 1.00
R2148:Bop1 UTSW 15 76455287 missense probably damaging 0.96
R3979:Bop1 UTSW 15 76453876 missense probably damaging 1.00
R4133:Bop1 UTSW 15 76454335 missense probably benign 0.24
R5396:Bop1 UTSW 15 76455289 missense probably damaging 1.00
R5434:Bop1 UTSW 15 76455411 missense probably benign 0.01
R5666:Bop1 UTSW 15 76454233 missense probably benign 0.00
R5820:Bop1 UTSW 15 76454841 missense probably damaging 1.00
R5883:Bop1 UTSW 15 76454849 missense probably damaging 1.00
R5907:Bop1 UTSW 15 76455917 missense probably damaging 1.00
R6807:Bop1 UTSW 15 76454983 missense probably damaging 0.99
R6947:Bop1 UTSW 15 76453988 missense probably damaging 1.00
R7232:Bop1 UTSW 15 76453346 missense probably damaging 1.00
R7395:Bop1 UTSW 15 76453841 missense probably damaging 1.00
R7477:Bop1 UTSW 15 76455326 missense probably damaging 1.00
R7792:Bop1 UTSW 15 76454348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTTCCTCTCCACAGGC -3'
(R):5'- TGATCCACCCTGTGACCAAC -3'

Sequencing Primer
(F):5'- AGGCTCCTGCTGCATCCAC -3'
(R):5'- TGTGACCAACCGCCCAG -3'
Posted On2019-11-12