Incidental Mutation 'R7725:Wdr43'
ID595468
Institutional Source Beutler Lab
Gene Symbol Wdr43
Ensembl Gene ENSMUSG00000041057
Gene NameWD repeat domain 43
Synonyms2610318G08Rik
Accession Numbers

Ncbi RefSeq: NM_175639.1; MGI:1919765

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71616215-71659031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71616343 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 28 (Y28C)
Ref Sequence ENSEMBL: ENSMUSP00000048337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047086]
Predicted Effect probably benign
Transcript: ENSMUST00000047086
AA Change: Y28C

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048337
Gene: ENSMUSG00000041057
AA Change: Y28C

DomainStartEndE-ValueType
WD40 8 42 4.42e1 SMART
WD40 45 110 2.2e2 SMART
WD40 113 154 7.85e-7 SMART
WD40 157 194 1.24e-4 SMART
WD40 197 249 5.52e0 SMART
Blast:WD40 256 299 1e-18 BLAST
low complexity region 320 334 N/A INTRINSIC
Pfam:Utp12 472 575 2.3e-23 PFAM
coiled coil region 635 663 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(36) : Gene trapped(36)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Wdr43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr43 APN 17 71652814 missense probably damaging 1.00
IGL02077:Wdr43 APN 17 71640291 missense probably benign 0.00
IGL02114:Wdr43 APN 17 71652848 missense probably benign 0.00
IGL02252:Wdr43 APN 17 71626850 missense probably damaging 1.00
IGL02352:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL02359:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL03082:Wdr43 APN 17 71638341 missense probably damaging 0.99
IGL03095:Wdr43 APN 17 71641287 missense probably benign 0.28
IGL02837:Wdr43 UTSW 17 71642736 missense probably benign 0.00
R0039:Wdr43 UTSW 17 71653492 nonsense probably null
R0164:Wdr43 UTSW 17 71631997 splice site probably benign
R0271:Wdr43 UTSW 17 71626825 missense probably benign 0.00
R1117:Wdr43 UTSW 17 71616387 missense probably benign 0.35
R1873:Wdr43 UTSW 17 71633652 missense probably benign 0.05
R1973:Wdr43 UTSW 17 71640240 missense probably benign 0.00
R3620:Wdr43 UTSW 17 71650606 missense probably benign 0.13
R3922:Wdr43 UTSW 17 71638301 splice site probably benign
R4097:Wdr43 UTSW 17 71657537 missense probably benign
R5067:Wdr43 UTSW 17 71626854 missense probably benign
R5282:Wdr43 UTSW 17 71648777 missense probably damaging 1.00
R6251:Wdr43 UTSW 17 71650053 splice site probably null
R6364:Wdr43 UTSW 17 71657654 missense probably damaging 0.96
R7086:Wdr43 UTSW 17 71616439 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCACGACCAGCCACTTCTTG -3'
(R):5'- GAGGCTTCGATGAACATGGC -3'

Sequencing Primer
(F):5'- ACTTCTTGGGCTCTCAGCG -3'
(R):5'- ATGAACATGGCGGCCCAG -3'
Posted On2019-11-12