Incidental Mutation 'R7725:Eef1g'
ID595469
Institutional Source Beutler Lab
Gene Symbol Eef1g
Ensembl Gene ENSMUSG00000071644
Gene Nameeukaryotic translation elongation factor 1 gamma
SynonymsEF1G, 2610301D06Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7725 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8967041-8978479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8978063 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 425 (H425Q)
Ref Sequence ENSEMBL: ENSMUSP00000093955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052248]
Predicted Effect probably benign
Transcript: ENSMUST00000052248
AA Change: H425Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000093955
Gene: ENSMUSG00000071644
AA Change: H425Q

DomainStartEndE-ValueType
Pfam:GST_N 2 81 1.5e-25 PFAM
Pfam:GST_N_3 6 83 1.4e-8 PFAM
Pfam:GST_C_3 88 194 8.3e-13 PFAM
Pfam:GST_C 106 198 4.5e-22 PFAM
Pfam:GST_C_2 125 191 8.6e-12 PFAM
low complexity region 238 262 N/A INTRINSIC
EF1G 275 381 3.63e-78 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Glb1l3 T A 9: 26,828,363 probably null Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Eef1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0577:Eef1g UTSW 19 8973042 missense probably benign 0.02
R1871:Eef1g UTSW 19 8977966 missense possibly damaging 0.80
R3946:Eef1g UTSW 19 8969977 missense probably benign 0.23
R4698:Eef1g UTSW 19 8977966 missense possibly damaging 0.70
R6112:Eef1g UTSW 19 8977591 missense probably damaging 1.00
R6672:Eef1g UTSW 19 8967047 utr 5 prime probably null
R6944:Eef1g UTSW 19 8968292 missense probably benign
R7665:Eef1g UTSW 19 8968289 missense probably benign 0.19
R7836:Eef1g UTSW 19 8977374 missense probably benign 0.10
R7919:Eef1g UTSW 19 8977374 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGAAATGGTGCCTCGATGTC -3'
(R):5'- TGAAAACTTCTGCCCTGCCAC -3'

Sequencing Primer
(F):5'- GATGTCCAGTGTCTAACCACATG -3'
(R):5'- TGCCACAAGGATGTCTCAG -3'
Posted On2019-11-12