Incidental Mutation 'R7726:Olfr1415'
ID 595471
Institutional Source Beutler Lab
Gene Symbol Olfr1415
Ensembl Gene ENSMUSG00000057464
Gene Name olfactory receptor 1415
Synonyms GA_x6K02T2R7CC-81266841-81267776, MOR103-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 92489101-92496101 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92491307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 149 (F149L)
Ref Sequence ENSEMBL: ENSMUSP00000145446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071521] [ENSMUST00000204009] [ENSMUST00000204766]
AlphaFold Q7TQS4
Predicted Effect probably benign
Transcript: ENSMUST00000071521
AA Change: F149L

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084047
Gene: ENSMUSG00000057464
AA Change: F149L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204009
AA Change: F149L

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145446
Gene: ENSMUSG00000057464
AA Change: F149L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204766
SMART Domains Protein: ENSMUSP00000144986
Gene: ENSMUSG00000057464

DomainStartEndE-ValueType
Blast:CLECT 1 65 1e-7 BLAST
Meta Mutation Damage Score 0.3480 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Olfr1415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Olfr1415 APN 1 92491583 missense probably damaging 1.00
R0538:Olfr1415 UTSW 1 92491333 missense possibly damaging 0.77
R0924:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R0930:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R1025:Olfr1415 UTSW 1 92491723 missense probably benign 0.19
R1201:Olfr1415 UTSW 1 92491153 missense probably benign 0.04
R1413:Olfr1415 UTSW 1 92490888 missense probably damaging 1.00
R1510:Olfr1415 UTSW 1 92491617 missense probably damaging 1.00
R1846:Olfr1415 UTSW 1 92491100 nonsense probably null
R1850:Olfr1415 UTSW 1 92491402 missense possibly damaging 0.89
R1940:Olfr1415 UTSW 1 92491735 missense probably benign 0.14
R2760:Olfr1415 UTSW 1 92491080 missense probably damaging 0.99
R4066:Olfr1415 UTSW 1 92491189 missense probably damaging 1.00
R4837:Olfr1415 UTSW 1 92490975 missense probably benign 0.39
R5310:Olfr1415 UTSW 1 92491036 missense probably damaging 1.00
R5503:Olfr1415 UTSW 1 92491196 missense probably benign 0.07
R5748:Olfr1415 UTSW 1 92491093 missense probably damaging 0.99
R5760:Olfr1415 UTSW 1 92491200 missense possibly damaging 0.95
R5853:Olfr1415 UTSW 1 92491717 missense probably benign 0.00
R5926:Olfr1415 UTSW 1 92491566 missense probably damaging 1.00
R6199:Olfr1415 UTSW 1 92491542 missense possibly damaging 0.89
R7585:Olfr1415 UTSW 1 92491320 missense probably benign 0.10
R7627:Olfr1415 UTSW 1 92491385 nonsense probably null
R8011:Olfr1415 UTSW 1 92491275 missense possibly damaging 0.60
R8306:Olfr1415 UTSW 1 92491525 missense possibly damaging 0.64
R9142:Olfr1415 UTSW 1 92491689 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACCAGAATGATGAAGGCC -3'
(R):5'- GACATCATCCCCAAAATGCTGG -3'

Sequencing Primer
(F):5'- TGATGAAGGCCAGGATGAAGTC -3'
(R):5'- CCAAAATGCTGGATGGCTTC -3'
Posted On 2019-11-12