Incidental Mutation 'R7726:Mettl11b'
List [record 1 of 65] next >> last >|
ID595473
Institutional Source Beutler Lab
Gene Symbol Mettl11b
Ensembl Gene ENSMUSG00000040113
Gene Namemethyltransferase like 11B
SynonymsLOC240879
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163702256-163725232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163703184 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 229 (C229R)
Ref Sequence ENSEMBL: ENSMUSP00000124211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159679] [ENSMUST00000160495]
Predicted Effect probably benign
Transcript: ENSMUST00000159679
AA Change: C229R

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124211
Gene: ENSMUSG00000040113
AA Change: C229R

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 64 278 5.7e-74 PFAM
Pfam:Methyltransf_11 121 220 4.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160495
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Mettl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Mettl11b APN 1 163725003 missense probably damaging 1.00
IGL01973:Mettl11b APN 1 163717120 missense probably benign 0.00
IGL02418:Mettl11b APN 1 163703156 missense probably damaging 1.00
IGL02597:Mettl11b APN 1 163717087 missense probably benign 0.00
IGL03060:Mettl11b APN 1 163717123 missense probably damaging 1.00
IGL03162:Mettl11b APN 1 163703214 missense probably damaging 0.98
R4569:Mettl11b UTSW 1 163703017 makesense probably null
R4618:Mettl11b UTSW 1 163725028 missense probably damaging 1.00
R4888:Mettl11b UTSW 1 163703064 missense probably benign 0.11
R5165:Mettl11b UTSW 1 163722523 missense probably benign 0.01
R6353:Mettl11b UTSW 1 163704111 missense possibly damaging 0.94
R6503:Mettl11b UTSW 1 163704146 missense probably damaging 1.00
R8092:Mettl11b UTSW 1 163717250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCATCGTTCAGTCTGG -3'
(R):5'- CAGAGGACTGTTTTGATTCTTAGC -3'

Sequencing Primer
(F):5'- ATTCCCACTGCTGATCAAGAGTG -3'
(R):5'- AGCCTTGTTTTCCTTCCAACTCAC -3'
Posted On2019-11-12