Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Stk4'

595475

Institutional Source

Beutler Lab

Gene Symbol

Stk4

Ensembl Gene

ENSMUSG00000018209

Gene Name

serine/threonine kinase 4

Synonyms

Ysk3, sterile 20-like kinase 1, Kas-2, Mst1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

164070322-164155524 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to G at 164110226 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 1 (M1R)

Ref Sequence

ENSEMBL: ENSMUSP00000085629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018353] [ENSMUST00000088291]

AlphaFold

Q9JI11

Predicted Effect

probably benign
Transcript: ENSMUST00000018353

SMART Domains

Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209

Domain	Start	End	E-Value	Type
S_TKc	30	281	1.97e-104	SMART
low complexity region	311	326	N/A	INTRINSIC
Pfam:Mst1_SARAH	433	480	2.4e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000088291
AA Change: M1R

SMART Domains

Protein: ENSMUSP00000085629
Gene: ENSMUSG00000018209
AA Change: M1R

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:Mst1_SARAH	71	119	3e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137866

SMART Domains

Protein: ENSMUSP00000116745
Gene: ENSMUSG00000018209

Domain	Start	End	E-Value	Type
Blast:S_TKc	2	26	8e-6	BLAST
PDB:3COM\|B	2	26	4e-7	PDB
low complexity region	27	42	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of naï¿½ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Stk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Stk4	APN	2	164118079	missense	probably benign	0.05
IGL01583:Stk4	APN	2	164074214	start codon destroyed	probably null	0.21
IGL01933:Stk4	APN	2	164098585	unclassified	probably benign
IGL02084:Stk4	APN	2	164086607	missense	probably benign	0.05
IGL02423:Stk4	APN	2	164086499	missense	probably benign	0.00
IGL02601:Stk4	APN	2	164086542	missense	probably damaging	1.00
IGL02712:Stk4	APN	2	164096897	missense	probably damaging	1.00
hallon	UTSW	2	164099827	critical splice donor site	probably null
iwo_jima	UTSW	2	164088959	missense	possibly damaging	0.94
ribeye	UTSW	2	164079566	missense	probably damaging	1.00
Sergeant	UTSW	2	164099712	missense	probably benign
stryker	UTSW	2	164083688	nonsense	probably null
R0377:Stk4	UTSW	2	164096800	missense	probably damaging	1.00
R0607:Stk4	UTSW	2	164098542	missense	probably damaging	1.00
R1403:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1403:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1404:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1404:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1405:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1405:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1406:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1406:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1972:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1973:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R1976:Stk4	UTSW	2	164100528	missense	probably benign	0.04
R2025:Stk4	UTSW	2	164096831	missense	probably damaging	1.00
R3155:Stk4	UTSW	2	164151743	missense	probably benign	0.01
R3732:Stk4	UTSW	2	164088908	missense	probably benign	0.05
R3732:Stk4	UTSW	2	164088908	missense	probably benign	0.05
R3733:Stk4	UTSW	2	164088908	missense	probably benign	0.05
R3734:Stk4	UTSW	2	164088908	missense	probably benign	0.05
R4288:Stk4	UTSW	2	164099712	missense	probably benign
R4296:Stk4	UTSW	2	164117984	missense	possibly damaging	0.69
R4360:Stk4	UTSW	2	164088959	missense	possibly damaging	0.94
R4829:Stk4	UTSW	2	164099827	critical splice donor site	probably null
R4954:Stk4	UTSW	2	164151681	missense	possibly damaging	0.75
R4954:Stk4	UTSW	2	164151682	missense	probably damaging	1.00
R5088:Stk4	UTSW	2	164083688	nonsense	probably null
R5188:Stk4	UTSW	2	164088908	missense	possibly damaging	0.85
R5283:Stk4	UTSW	2	164110279	nonsense	probably null
R5554:Stk4	UTSW	2	164099725	missense	probably benign
R5605:Stk4	UTSW	2	164079566	missense	probably damaging	1.00
R5694:Stk4	UTSW	2	164100564	missense	possibly damaging	0.87
R5711:Stk4	UTSW	2	164099754	missense	probably benign	0.20
R7453:Stk4	UTSW	2	164086602	missense	probably benign	0.01
R7698:Stk4	UTSW	2	164083743	missense	probably damaging	1.00
R8177:Stk4	UTSW	2	164088857	missense	probably damaging	0.99
R9076:Stk4	UTSW	2	164118065	missense	probably benign
R9378:Stk4	UTSW	2	164110216	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGCATCTTACAACCCTCAG -3'
(R):5'- TCTTGAAGTAAAGAGATAAGACCCC -3'

Sequencing Primer
(F):5'- AGACCCTCTGTGATGCATTTG -3'
(R):5'- GTAAAGAGATAAGACCCCTTCGTC -3'

Posted On

2019-11-12