Incidental Mutation 'R7726:Stk4'
ID 595475
Institutional Source Beutler Lab
Gene Symbol Stk4
Ensembl Gene ENSMUSG00000018209
Gene Name serine/threonine kinase 4
Synonyms sterile 20-like kinase 1, Kas-2, Ysk3, Mst1
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 163916033-163997444 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to G at 163952146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000085629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018353] [ENSMUST00000088291]
AlphaFold Q9JI11
Predicted Effect probably benign
Transcript: ENSMUST00000018353
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088291
AA Change: M1R
SMART Domains Protein: ENSMUSP00000085629
Gene: ENSMUSG00000018209
AA Change: M1R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:Mst1_SARAH 71 119 3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137866
SMART Domains Protein: ENSMUSP00000116745
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
Blast:S_TKc 2 26 8e-6 BLAST
PDB:3COM|B 2 26 4e-7 PDB
low complexity region 27 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Stk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 163,959,999 (GRCm39) missense probably benign 0.05
IGL01583:Stk4 APN 2 163,916,134 (GRCm39) start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 163,940,505 (GRCm39) unclassified probably benign
IGL02084:Stk4 APN 2 163,928,527 (GRCm39) missense probably benign 0.05
IGL02423:Stk4 APN 2 163,928,419 (GRCm39) missense probably benign 0.00
IGL02601:Stk4 APN 2 163,928,462 (GRCm39) missense probably damaging 1.00
IGL02712:Stk4 APN 2 163,938,817 (GRCm39) missense probably damaging 1.00
hallon UTSW 2 163,941,747 (GRCm39) critical splice donor site probably null
iwo_jima UTSW 2 163,930,879 (GRCm39) missense possibly damaging 0.94
ribeye UTSW 2 163,921,486 (GRCm39) missense probably damaging 1.00
Sergeant UTSW 2 163,941,632 (GRCm39) missense probably benign
stryker UTSW 2 163,925,608 (GRCm39) nonsense probably null
R0377:Stk4 UTSW 2 163,938,720 (GRCm39) missense probably damaging 1.00
R0607:Stk4 UTSW 2 163,940,462 (GRCm39) missense probably damaging 1.00
R1403:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1403:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1404:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1404:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1405:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1405:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1406:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1406:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1972:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1973:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R1976:Stk4 UTSW 2 163,942,448 (GRCm39) missense probably benign 0.04
R2025:Stk4 UTSW 2 163,938,751 (GRCm39) missense probably damaging 1.00
R3155:Stk4 UTSW 2 163,993,663 (GRCm39) missense probably benign 0.01
R3732:Stk4 UTSW 2 163,930,828 (GRCm39) missense probably benign 0.05
R3732:Stk4 UTSW 2 163,930,828 (GRCm39) missense probably benign 0.05
R3733:Stk4 UTSW 2 163,930,828 (GRCm39) missense probably benign 0.05
R3734:Stk4 UTSW 2 163,930,828 (GRCm39) missense probably benign 0.05
R4288:Stk4 UTSW 2 163,941,632 (GRCm39) missense probably benign
R4296:Stk4 UTSW 2 163,959,904 (GRCm39) missense possibly damaging 0.69
R4360:Stk4 UTSW 2 163,930,879 (GRCm39) missense possibly damaging 0.94
R4829:Stk4 UTSW 2 163,941,747 (GRCm39) critical splice donor site probably null
R4954:Stk4 UTSW 2 163,993,602 (GRCm39) missense probably damaging 1.00
R4954:Stk4 UTSW 2 163,993,601 (GRCm39) missense possibly damaging 0.75
R5088:Stk4 UTSW 2 163,925,608 (GRCm39) nonsense probably null
R5188:Stk4 UTSW 2 163,930,828 (GRCm39) missense possibly damaging 0.85
R5283:Stk4 UTSW 2 163,952,199 (GRCm39) nonsense probably null
R5554:Stk4 UTSW 2 163,941,645 (GRCm39) missense probably benign
R5605:Stk4 UTSW 2 163,921,486 (GRCm39) missense probably damaging 1.00
R5694:Stk4 UTSW 2 163,942,484 (GRCm39) missense possibly damaging 0.87
R5711:Stk4 UTSW 2 163,941,674 (GRCm39) missense probably benign 0.20
R7453:Stk4 UTSW 2 163,928,522 (GRCm39) missense probably benign 0.01
R7698:Stk4 UTSW 2 163,925,663 (GRCm39) missense probably damaging 1.00
R8177:Stk4 UTSW 2 163,930,777 (GRCm39) missense probably damaging 0.99
R9076:Stk4 UTSW 2 163,959,985 (GRCm39) missense probably benign
R9378:Stk4 UTSW 2 163,952,136 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- GGGCATCTTACAACCCTCAG -3'
(R):5'- TCTTGAAGTAAAGAGATAAGACCCC -3'

Sequencing Primer
(F):5'- AGACCCTCTGTGATGCATTTG -3'
(R):5'- GTAAAGAGATAAGACCCCTTCGTC -3'
Posted On 2019-11-12