Incidental Mutation 'R7726:Wfdc8'
List |< first << previous [record 63 of 65] next >> last >|
ID595476
Institutional Source Beutler Lab
Gene Symbol Wfdc8
Ensembl Gene ENSMUSG00000070533
Gene NameWAP four-disulfide core domain 8
SynonymsLOC277343
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164596458-164613626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 164599986 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 215 (E215D)
Ref Sequence ENSEMBL: ENSMUSP00000104963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094351] [ENSMUST00000109338] [ENSMUST00000109339]
Predicted Effect probably benign
Transcript: ENSMUST00000094351
AA Change: E215D

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091911
Gene: ENSMUSG00000070533
AA Change: E215D

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109338
AA Change: E215D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104962
Gene: ENSMUSG00000070533
AA Change: E215D

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
WAP 229 272 1.84e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109339
AA Change: E215D

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104963
Gene: ENSMUSG00000070533
AA Change: E215D

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 384 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains a Kunitz-inhibitor domain, in addition to three WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Wfdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Wfdc8 APN 2 164605780 missense probably damaging 1.00
IGL02012:Wfdc8 APN 2 164603150 splice site probably benign
IGL02831:Wfdc8 APN 2 164605765 critical splice donor site probably null
PIT4131001:Wfdc8 UTSW 2 164597776 missense possibly damaging 0.94
PIT4520001:Wfdc8 UTSW 2 164603303 missense probably benign 0.09
R0006:Wfdc8 UTSW 2 164599064 missense probably damaging 0.96
R0225:Wfdc8 UTSW 2 164597185 missense probably benign 0.04
R0603:Wfdc8 UTSW 2 164603225 missense probably damaging 1.00
R1741:Wfdc8 UTSW 2 164608869 unclassified probably benign
R5484:Wfdc8 UTSW 2 164597729 missense probably benign 0.11
R5546:Wfdc8 UTSW 2 164597319 utr 3 prime probably benign
R5614:Wfdc8 UTSW 2 164603203 missense probably damaging 1.00
R5668:Wfdc8 UTSW 2 164597419 utr 3 prime probably benign
R6410:Wfdc8 UTSW 2 164597743 missense probably benign 0.10
R6869:Wfdc8 UTSW 2 164599092 missense possibly damaging 0.82
R7770:Wfdc8 UTSW 2 164597674 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGGACTTCTTCACCTCTCAG -3'
(R):5'- CCCTGAGGAGAAGAGCTTTC -3'

Sequencing Primer
(F):5'- TCTATAGTGAGATCTAGACCAGGC -3'
(R):5'- CCCTGAGGAGAAGAGCTTTCTGAAG -3'
Posted On2019-11-12