Incidental Mutation 'R7726:Manba'
ID 595481
Institutional Source Beutler Lab
Gene Symbol Manba
Ensembl Gene ENSMUSG00000028164
Gene Name mannosidase, beta A, lysosomal
Synonyms B930014J03Rik, Bmn, 2410030O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 135485611-135571404 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 135518009 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 219 (T219M)
Ref Sequence ENSEMBL: ENSMUSP00000029814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029814] [ENSMUST00000131610]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029814
AA Change: T219M

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: T219M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 42 211 6.5e-11 PFAM
Pfam:Glyco_hydro_2_C 340 595 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131610
SMART Domains Protein: ENSMUSP00000122148
Gene: ENSMUSG00000028164

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 22 163 1.8e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Manba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Manba APN 3 135554780 nonsense probably null
IGL01443:Manba APN 3 135544828 missense probably damaging 1.00
IGL01796:Manba APN 3 135542389 missense probably damaging 1.00
IGL02396:Manba APN 3 135544764 missense probably damaging 1.00
IGL02471:Manba APN 3 135507008 splice site probably benign
IGL02809:Manba APN 3 135547560 missense probably damaging 1.00
IGL02861:Manba APN 3 135570263 missense probably benign 0.03
IGL02934:Manba APN 3 135544749 missense probably benign 0.00
IGL03130:Manba APN 3 135551159 missense probably damaging 1.00
IGL03237:Manba APN 3 135544751 missense probably damaging 1.00
IGL03342:Manba APN 3 135517987 missense possibly damaging 0.51
R0551:Manba UTSW 3 135517973 missense probably damaging 0.98
R1549:Manba UTSW 3 135544806 missense probably damaging 1.00
R1752:Manba UTSW 3 135506945 missense probably damaging 1.00
R1932:Manba UTSW 3 135544740 missense probably benign 0.01
R1991:Manba UTSW 3 135551191 missense probably benign 0.05
R3729:Manba UTSW 3 135554850 missense probably benign 0.00
R3731:Manba UTSW 3 135554850 missense probably benign 0.00
R3813:Manba UTSW 3 135563262 missense possibly damaging 0.67
R4712:Manba UTSW 3 135544814 missense probably damaging 1.00
R5001:Manba UTSW 3 135567630 missense probably benign 0.00
R5481:Manba UTSW 3 135524556 missense possibly damaging 0.86
R5889:Manba UTSW 3 135524598 nonsense probably null
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6434:Manba UTSW 3 135511973 splice site probably null
R6760:Manba UTSW 3 135542451 missense probably damaging 0.98
R7164:Manba UTSW 3 135542388 missense probably damaging 1.00
R7182:Manba UTSW 3 135567513 missense probably benign 0.06
R7184:Manba UTSW 3 135523154 missense possibly damaging 0.62
R7212:Manba UTSW 3 135567635 missense probably benign
R7266:Manba UTSW 3 135517912 missense probably damaging 1.00
R7271:Manba UTSW 3 135542376 missense probably damaging 1.00
R7466:Manba UTSW 3 135542393 missense probably benign 0.13
R7467:Manba UTSW 3 135544801 missense probably damaging 1.00
R7542:Manba UTSW 3 135566593 missense probably benign 0.10
R7546:Manba UTSW 3 135570246 missense probably benign 0.01
R8475:Manba UTSW 3 135511812 missense probably benign 0.13
R8768:Manba UTSW 3 135551234 missense probably damaging 1.00
R8856:Manba UTSW 3 135518003 missense probably damaging 0.98
R9140:Manba UTSW 3 135485729 missense probably benign
R9449:Manba UTSW 3 135549318 missense probably benign 0.01
Z1176:Manba UTSW 3 135563274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATGTATCATAGTGTCTTCGTAC -3'
(R):5'- CTATCTACAGGCCTGGTTTATGCTG -3'

Sequencing Primer
(F):5'- CATAGTGTCTTCGTACACACATATC -3'
(R):5'- TGCTGTAAGTTTTCATGACAAACC -3'
Posted On 2019-11-12