Incidental Mutation 'R7726:Msh4'
ID595482
Institutional Source Beutler Lab
Gene Symbol Msh4
Ensembl Gene ENSMUSG00000005493
Gene NamemutS homolog 4
SynonymsmMsh4, 4930485C04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R7726 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location153857149-153906138 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 153866320 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]
Predicted Effect probably null
Transcript: ENSMUST00000005630
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000188338
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000190449
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Msh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Msh4 APN 3 153883735 missense possibly damaging 0.88
IGL01098:Msh4 APN 3 153877982 splice site probably benign
IGL01609:Msh4 APN 3 153897397 missense probably damaging 1.00
IGL01785:Msh4 APN 3 153857507 missense probably damaging 1.00
IGL01939:Msh4 APN 3 153857589 missense probably damaging 1.00
IGL02022:Msh4 APN 3 153886956 missense probably damaging 1.00
IGL02209:Msh4 APN 3 153888862 missense probably damaging 1.00
IGL02224:Msh4 APN 3 153890185 missense possibly damaging 0.94
IGL02240:Msh4 APN 3 153873674 missense probably damaging 0.98
IGL02493:Msh4 APN 3 153877908 critical splice donor site probably null
IGL02576:Msh4 APN 3 153867746 missense probably damaging 1.00
IGL02616:Msh4 APN 3 153857523 missense probably benign
IGL02812:Msh4 APN 3 153901400 splice site probably benign
IGL02888:Msh4 APN 3 153896913 nonsense probably null
IGL02992:Msh4 APN 3 153872325 missense possibly damaging 0.79
IGL03191:Msh4 APN 3 153869608 missense probably damaging 0.97
P0021:Msh4 UTSW 3 153888818 missense probably damaging 1.00
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0368:Msh4 UTSW 3 153888825 missense probably damaging 1.00
R0377:Msh4 UTSW 3 153896890 missense probably benign 0.00
R0631:Msh4 UTSW 3 153866420 missense probably benign 0.02
R0632:Msh4 UTSW 3 153896895 missense probably damaging 1.00
R0677:Msh4 UTSW 3 153879367 missense possibly damaging 0.69
R0909:Msh4 UTSW 3 153863504 missense probably benign 0.00
R1081:Msh4 UTSW 3 153872358 missense probably benign 0.06
R1463:Msh4 UTSW 3 153857570 missense probably damaging 1.00
R1476:Msh4 UTSW 3 153863384 missense probably damaging 1.00
R1669:Msh4 UTSW 3 153876720 missense possibly damaging 0.47
R1733:Msh4 UTSW 3 153867767 missense probably damaging 1.00
R1859:Msh4 UTSW 3 153905880 missense probably benign
R2168:Msh4 UTSW 3 153867835 nonsense probably null
R2378:Msh4 UTSW 3 153863477 missense probably damaging 0.99
R2991:Msh4 UTSW 3 153905860 missense probably benign
R3025:Msh4 UTSW 3 153863491 missense probably damaging 1.00
R4604:Msh4 UTSW 3 153872283 missense probably damaging 1.00
R4757:Msh4 UTSW 3 153879387 missense probably damaging 0.99
R5205:Msh4 UTSW 3 153866412 missense probably damaging 1.00
R5285:Msh4 UTSW 3 153873713 missense probably benign 0.03
R5766:Msh4 UTSW 3 153867840 missense probably damaging 1.00
R5777:Msh4 UTSW 3 153863439 missense probably benign 0.01
R5888:Msh4 UTSW 3 153867723 critical splice donor site probably null
R7384:Msh4 UTSW 3 153888748 missense probably benign 0.23
R7408:Msh4 UTSW 3 153876745 missense probably benign 0.06
R7487:Msh4 UTSW 3 153863510 missense probably damaging 1.00
R7503:Msh4 UTSW 3 153867750 missense probably damaging 1.00
Z1177:Msh4 UTSW 3 153879368 missense probably benign 0.00
Z1177:Msh4 UTSW 3 153901443 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTCATCTATATCCTGTATGCACAAC -3'
(R):5'- ACAGCATTGCTTGGGTATAATG -3'

Sequencing Primer
(F):5'- CTGGAACTCATTCTGTAGACCAGG -3'
(R):5'- CAGCATTGCTTGGGTATAATGAATAG -3'
Posted On2019-11-12