Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Lyn'

595483

Institutional Source

Beutler Lab

Gene Symbol

Lyn

Ensembl Gene

ENSMUSG00000042228

Gene Name

LYN proto-oncogene, Src family tyrosine kinase

Synonyms

Hck-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

91.0077

Status

Not validated

Chromosome

Chromosomal Location

3678115-3813122 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 3756428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 306 (Y306*)

Ref Sequence

ENSEMBL: ENSMUSP00000038838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]

AlphaFold

P25911

PDB Structure

Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION]
Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000041377
AA Change: Y306*

SMART Domains

Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: Y306*

Domain	Start	End	E-Value	Type
SH3	66	122	9.24e-21	SMART
SH2	127	217	5.38e-33	SMART
TyrKc	247	497	3.25e-137	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000103010
AA Change: Y285*

SMART Domains

Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: Y285*

Domain	Start	End	E-Value	Type
SH3	45	101	5.8e-23	SMART
SH2	106	196	3.3e-35	SMART
TyrKc	226	476	1.6e-139	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Lyn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01752:Lyn	APN	4	3743286	missense	probably benign
IGL02744:Lyn	APN	4	3738808	missense	probably benign	0.00
IGL02860:Lyn	APN	4	3745594	missense	possibly damaging	0.77
IGL03328:Lyn	APN	4	3745327	missense	probably benign	0.01
IGL03370:Lyn	APN	4	3780931	missense	possibly damaging	0.81
bibb	UTSW	4	3783055	missense	probably damaging	1.00
butterhead	UTSW	4	3748765	missense	probably benign	0.11
Cress	UTSW	4	3789908	nonsense	probably null
Friede	UTSW	4	3789834	nonsense	probably null
Kohlrabi	UTSW	4	3783089	missense	possibly damaging	0.74
lechuga	UTSW	4	3783050	missense	probably damaging	1.00
Lemon	UTSW	4	3746768	missense	probably damaging	1.00
Pacific	UTSW	4	3745330	missense	probably damaging	1.00
water	UTSW	4	3748787	missense	possibly damaging	0.93
R0079:Lyn	UTSW	4	3746768	missense	probably damaging	1.00
R0089:Lyn	UTSW	4	3748768	missense	probably benign	0.23
R0582:Lyn	UTSW	4	3743296	missense	probably damaging	1.00
R0747:Lyn	UTSW	4	3745638	splice site	probably benign
R1460:Lyn	UTSW	4	3789908	nonsense	probably null
R1615:Lyn	UTSW	4	3748765	missense	probably benign	0.11
R1654:Lyn	UTSW	4	3789912	missense	probably damaging	0.99
R1703:Lyn	UTSW	4	3738867	splice site	probably null
R2301:Lyn	UTSW	4	3780959	missense	probably damaging	1.00
R2421:Lyn	UTSW	4	3748787	missense	possibly damaging	0.93
R2512:Lyn	UTSW	4	3745542	missense	probably benign	0.01
R3418:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3419:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3701:Lyn	UTSW	4	3742455	missense	probably benign
R3702:Lyn	UTSW	4	3742455	missense	probably benign
R3736:Lyn	UTSW	4	3745330	missense	probably damaging	1.00
R4350:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4351:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4352:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4649:Lyn	UTSW	4	3738850	missense	probably benign
R5738:Lyn	UTSW	4	3782987	missense	probably damaging	1.00
R5875:Lyn	UTSW	4	3745631	splice site	probably null
R6375:Lyn	UTSW	4	3745527	missense	probably damaging	1.00
R7029:Lyn	UTSW	4	3782996	missense	probably damaging	0.98
R7621:Lyn	UTSW	4	3789834	nonsense	probably null
R7940:Lyn	UTSW	4	3783089	missense	possibly damaging	0.74
R8169:Lyn	UTSW	4	3783050	missense	probably damaging	1.00
R8341:Lyn	UTSW	4	3743304	critical splice donor site	probably null
R8782:Lyn	UTSW	4	3783055	missense	probably damaging	1.00
R9056:Lyn	UTSW	4	3780925	missense	possibly damaging	0.89
R9353:Lyn	UTSW	4	3746804	missense	possibly damaging	0.71
R9567:Lyn	UTSW	4	3746757	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGCCTTCTCAGTCTGTAAATAAGC -3'
(R):5'- AAATGCTGTCCCCAGGCTATG -3'

Sequencing Primer
(F):5'- CTCCAGCTCTGCATTTAGGAGG -3'
(R):5'- TCCCCAGGCTATGACTGTGAAATG -3'

Posted On

2019-11-12