Incidental Mutation 'R7726:Klk1b9'
List |< first << previous [record 35 of 65] next >> last >|
ID595493
Institutional Source Beutler Lab
Gene Symbol Klk1b9
Ensembl Gene ENSMUSG00000059042
Gene Namekallikrein 1-related peptidase b9
SynonymsKlk9, Egfbp3, mGk-9, Egfbp-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43976061-43980376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43978416 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 46 (N46I)
Ref Sequence ENSEMBL: ENSMUSP00000080133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081399]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081399
AA Change: N46I

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080133
Gene: ENSMUSG00000059042
AA Change: N46I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.54e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Klk1b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Klk1b9 APN 7 43978454 missense probably damaging 1.00
IGL01330:Klk1b9 APN 7 43978443 nonsense probably null
IGL03329:Klk1b9 APN 7 43979414 missense probably benign 0.00
R0206:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R0208:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R0632:Klk1b9 UTSW 7 43979372 missense possibly damaging 0.56
R1289:Klk1b9 UTSW 7 43978424 missense probably benign
R1437:Klk1b9 UTSW 7 43979690 missense probably damaging 1.00
R1994:Klk1b9 UTSW 7 43979555 missense probably benign 0.04
R5006:Klk1b9 UTSW 7 43979287 nonsense probably null
R6572:Klk1b9 UTSW 7 43979735 missense probably benign
R7149:Klk1b9 UTSW 7 43979417 missense probably benign 0.30
R7911:Klk1b9 UTSW 7 43979787 missense probably damaging 1.00
R7992:Klk1b9 UTSW 7 43979787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAATGTCCCCTGAACCC -3'
(R):5'- TACTCTGAACCCAAGACTGGATG -3'

Sequencing Primer
(F):5'- TGAACCCCATCCTGCTTAAC -3'
(R):5'- TCACAGATAAACTTTCATCCAGTCC -3'
Posted On2019-11-12