Mutagenetix > Incidental Mutations

Incidental Mutation 'R7726:Iqgap1'

595494

Institutional Source

Beutler Lab

Gene Symbol

Iqgap1

Ensembl Gene

ENSMUSG00000030536

Gene Name

IQ motif containing GTPase activating protein 1

Synonyms

D7Ertd237e, D7Ertd257e

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80711583-80825974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80757456 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 342 (N342S)

Ref Sequence

ENSEMBL: ENSMUSP00000128278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167377]

Predicted Effect

probably benign
Transcript: ENSMUST00000167377
AA Change: N342S

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: N342S

Domain	Start	End	E-Value	Type
CH	46	155	2.02e-20	SMART
internal_repeat_1	203	278	3.71e-8	PROSPERO
low complexity region	324	335	N/A	INTRINSIC
low complexity region	390	399	N/A	INTRINSIC
coiled coil region	488	515	N/A	INTRINSIC
internal_repeat_1	608	684	3.71e-8	PROSPERO
IQ	744	766	3.85e-3	SMART
IQ	774	796	1.12e-4	SMART
IQ	804	826	1.32e-1	SMART
IQ	834	856	1.15e1	SMART
coiled coil region	886	914	N/A	INTRINSIC
RasGAP	992	1345	7.46e-89	SMART
Pfam:RasGAP_C	1452	1580	4.5e-41	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Peg10	C	CTCG	6: 4,756,453		probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Iqgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Iqgap1	APN	7	80759844	missense	probably benign	0.00
IGL00984:Iqgap1	APN	7	80726798	missense	probably damaging	1.00
IGL01570:Iqgap1	APN	7	80723061	missense	possibly damaging	0.76
IGL01738:Iqgap1	APN	7	80723900	missense	possibly damaging	0.80
IGL02141:Iqgap1	APN	7	80738121	missense	probably damaging	1.00
IGL02336:Iqgap1	APN	7	80752293	missense	probably benign	0.39
IGL02416:Iqgap1	APN	7	80726038	missense	probably damaging	1.00
IGL02597:Iqgap1	APN	7	80723885	missense	probably damaging	1.00
IGL02662:Iqgap1	APN	7	80743079	missense	probably benign
IGL03157:Iqgap1	APN	7	80751888	missense	probably benign	0.34
IGL03189:Iqgap1	APN	7	80713842	missense	probably benign	0.12
IGL03216:Iqgap1	APN	7	80743088	missense	probably benign	0.33
R0024:Iqgap1	UTSW	7	80751939	missense	probably benign
R0126:Iqgap1	UTSW	7	80738322	missense	probably benign	0.00
R0144:Iqgap1	UTSW	7	80751920	missense	probably damaging	1.00
R0325:Iqgap1	UTSW	7	80751930	missense	probably benign	0.01
R0376:Iqgap1	UTSW	7	80723879	missense	probably benign	0.01
R0650:Iqgap1	UTSW	7	80736395	missense	probably damaging	1.00
R0652:Iqgap1	UTSW	7	80736395	missense	probably damaging	1.00
R0741:Iqgap1	UTSW	7	80720987	missense	probably benign	0.03
R0751:Iqgap1	UTSW	7	80725573	unclassified	probably benign
R1067:Iqgap1	UTSW	7	80723828	missense	probably benign	0.01
R1389:Iqgap1	UTSW	7	80759756	critical splice donor site	probably null
R1473:Iqgap1	UTSW	7	80734011	missense	probably benign	0.00
R1613:Iqgap1	UTSW	7	80768457	missense	probably damaging	1.00
R1842:Iqgap1	UTSW	7	80760883	missense	probably damaging	1.00
R1909:Iqgap1	UTSW	7	80743828	missense	probably benign
R2062:Iqgap1	UTSW	7	80723979	nonsense	probably null
R2149:Iqgap1	UTSW	7	80762560	missense	probably damaging	1.00
R2153:Iqgap1	UTSW	7	80751953	missense	probably benign	0.00
R2153:Iqgap1	UTSW	7	80759903	missense	possibly damaging	0.55
R3160:Iqgap1	UTSW	7	80752338	missense	probably benign
R3162:Iqgap1	UTSW	7	80752338	missense	probably benign
R3605:Iqgap1	UTSW	7	80723789	missense	probably benign	0.02
R3709:Iqgap1	UTSW	7	80717087	missense	possibly damaging	0.87
R3935:Iqgap1	UTSW	7	80743837	missense	possibly damaging	0.54
R3979:Iqgap1	UTSW	7	80759934	missense	probably damaging	0.98
R4545:Iqgap1	UTSW	7	80762567	critical splice acceptor site	probably null
R4787:Iqgap1	UTSW	7	80735513	missense	probably damaging	1.00
R4925:Iqgap1	UTSW	7	80765317	missense	probably damaging	1.00
R4953:Iqgap1	UTSW	7	80723776	splice site	probably null
R5037:Iqgap1	UTSW	7	80734100	missense	probably damaging	1.00
R5158:Iqgap1	UTSW	7	80743068	missense	probably benign	0.02
R5183:Iqgap1	UTSW	7	80723065	missense	probably damaging	1.00
R5262:Iqgap1	UTSW	7	80726742	missense	probably benign	0.00
R5271:Iqgap1	UTSW	7	80734148	missense	probably damaging	1.00
R5289:Iqgap1	UTSW	7	80738724	missense	possibly damaging	0.88
R5359:Iqgap1	UTSW	7	80766959	missense	probably benign	0.00
R5423:Iqgap1	UTSW	7	80799862	missense	probably damaging	1.00
R5843:Iqgap1	UTSW	7	80726080	missense	probably benign	0.03
R5849:Iqgap1	UTSW	7	80803158	missense	probably benign
R6164:Iqgap1	UTSW	7	80809106	missense	unknown
R6315:Iqgap1	UTSW	7	80799890	missense	possibly damaging	0.65
R6335:Iqgap1	UTSW	7	80728024	missense	probably damaging	1.00
R6488:Iqgap1	UTSW	7	80730326	missense	probably benign	0.00
R6723:Iqgap1	UTSW	7	80723822	missense	probably benign	0.01
R6800:Iqgap1	UTSW	7	80728981	missense	possibly damaging	0.56
R6815:Iqgap1	UTSW	7	80766884	critical splice donor site	probably null
R7240:Iqgap1	UTSW	7	80759839	missense	probably benign	0.22
R7386:Iqgap1	UTSW	7	80726042	missense	probably damaging	1.00
R7387:Iqgap1	UTSW	7	80720990	missense	probably benign	0.03
R7410:Iqgap1	UTSW	7	80723030	nonsense	probably null
R7429:Iqgap1	UTSW	7	80751440	missense	probably benign	0.00
R7452:Iqgap1	UTSW	7	80760829	missense	possibly damaging	0.80
R7615:Iqgap1	UTSW	7	80730100	missense	probably damaging	1.00
R7615:Iqgap1	UTSW	7	80751346	missense	probably benign
R7783:Iqgap1	UTSW	7	80809059	missense	probably benign	0.01
R7785:Iqgap1	UTSW	7	80738169	missense	probably damaging	1.00
R7862:Iqgap1	UTSW	7	80743888	missense	probably benign	0.04
R7945:Iqgap1	UTSW	7	80743888	missense	probably benign	0.04
RF004:Iqgap1	UTSW	7	80720875	missense	probably benign
RF063:Iqgap1	UTSW	7	80723751	frame shift	probably null
X0064:Iqgap1	UTSW	7	80720931	nonsense	probably null
X0067:Iqgap1	UTSW	7	80766903	missense	probably benign
Z1176:Iqgap1	UTSW	7	80768309	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGGACCAGACACTTGTGG -3'
(R):5'- AAGGAAGATTCTCTAGGCTGTTG -3'

Sequencing Primer
(F):5'- CCAGACACTTGTGGGAACAGC -3'
(R):5'- AAGATTCTCTAGGCTGTTGTGTTAC -3'

Posted On

2019-11-12