Incidental Mutation 'R7726:Adam34'
ID 595496
Institutional Source Beutler Lab
Gene Symbol Adam34
Ensembl Gene ENSMUSG00000079058
Gene Name a disintegrin and metallopeptidase domain 34
Synonyms testase 4
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 44103346-44118597 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 44104208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 479 (N479T)
Ref Sequence ENSEMBL: ENSMUSP00000148332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110411] [ENSMUST00000212185]
AlphaFold A2RSG8
Predicted Effect probably damaging
Transcript: ENSMUST00000110411
AA Change: N479T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106041
Gene: ENSMUSG00000079058
AA Change: N479T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 159 5.9e-20 PFAM
Pfam:Reprolysin_5 205 377 1.6e-16 PFAM
Pfam:Reprolysin_4 205 393 3e-12 PFAM
Pfam:Reprolysin 207 397 9.4e-49 PFAM
Pfam:Reprolysin_2 224 389 1e-14 PFAM
Pfam:Reprolysin_3 231 352 2.7e-14 PFAM
DISIN 416 491 3.38e-40 SMART
ACR 492 628 9.18e-62 SMART
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212185
AA Change: N479T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Adam34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Adam34 APN 8 44,105,227 (GRCm39) missense possibly damaging 0.91
IGL01296:Adam34 APN 8 44,104,178 (GRCm39) missense possibly damaging 0.90
IGL01369:Adam34 APN 8 44,104,094 (GRCm39) missense probably benign 0.00
IGL01933:Adam34 APN 8 44,104,569 (GRCm39) missense probably damaging 1.00
IGL01938:Adam34 APN 8 44,104,053 (GRCm39) missense probably damaging 1.00
IGL02112:Adam34 APN 8 44,104,175 (GRCm39) missense possibly damaging 0.46
IGL02182:Adam34 APN 8 44,104,790 (GRCm39) missense probably benign
IGL02306:Adam34 APN 8 44,103,522 (GRCm39) missense probably benign 0.44
IGL02661:Adam34 APN 8 44,104,572 (GRCm39) missense probably damaging 1.00
IGL02888:Adam34 APN 8 44,104,610 (GRCm39) missense probably damaging 1.00
IGL02979:Adam34 APN 8 44,104,408 (GRCm39) missense probably damaging 1.00
IGL03073:Adam34 APN 8 44,103,940 (GRCm39) missense probably damaging 0.99
BB010:Adam34 UTSW 8 44,103,911 (GRCm39) missense probably damaging 1.00
BB020:Adam34 UTSW 8 44,103,911 (GRCm39) missense probably damaging 1.00
PIT4453001:Adam34 UTSW 8 44,104,349 (GRCm39) missense probably damaging 1.00
R0060:Adam34 UTSW 8 44,128,920 (GRCm39) intron probably benign
R0317:Adam34 UTSW 8 44,105,288 (GRCm39) missense probably benign 0.14
R0322:Adam34 UTSW 8 44,104,958 (GRCm39) missense probably benign 0.00
R0427:Adam34 UTSW 8 44,105,493 (GRCm39) missense probably benign 0.15
R0593:Adam34 UTSW 8 44,104,724 (GRCm39) missense possibly damaging 0.87
R0837:Adam34 UTSW 8 44,104,537 (GRCm39) missense probably benign 0.00
R0927:Adam34 UTSW 8 44,104,621 (GRCm39) missense probably damaging 1.00
R1634:Adam34 UTSW 8 44,105,127 (GRCm39) missense possibly damaging 0.81
R1653:Adam34 UTSW 8 44,103,682 (GRCm39) nonsense probably null
R1826:Adam34 UTSW 8 44,104,379 (GRCm39) missense probably damaging 1.00
R1873:Adam34 UTSW 8 44,104,843 (GRCm39) missense probably benign 0.02
R1943:Adam34 UTSW 8 44,104,852 (GRCm39) missense probably damaging 1.00
R1943:Adam34 UTSW 8 44,103,864 (GRCm39) missense possibly damaging 0.48
R2147:Adam34 UTSW 8 44,105,538 (GRCm39) missense probably benign 0.01
R2150:Adam34 UTSW 8 44,105,538 (GRCm39) missense probably benign 0.01
R2206:Adam34 UTSW 8 44,105,274 (GRCm39) missense probably benign 0.02
R2207:Adam34 UTSW 8 44,105,274 (GRCm39) missense probably benign 0.02
R2268:Adam34 UTSW 8 44,103,647 (GRCm39) missense probably benign 0.00
R2349:Adam34 UTSW 8 44,105,415 (GRCm39) missense probably damaging 0.99
R3983:Adam34 UTSW 8 44,103,806 (GRCm39) missense probably benign
R4158:Adam34 UTSW 8 44,103,854 (GRCm39) missense probably damaging 1.00
R4179:Adam34 UTSW 8 44,104,128 (GRCm39) missense probably benign 0.18
R5219:Adam34 UTSW 8 44,104,461 (GRCm39) missense probably benign
R5398:Adam34 UTSW 8 44,104,278 (GRCm39) missense probably damaging 1.00
R5611:Adam34 UTSW 8 44,104,749 (GRCm39) missense probably benign 0.43
R5928:Adam34 UTSW 8 44,105,067 (GRCm39) missense probably benign 0.08
R6115:Adam34 UTSW 8 44,105,098 (GRCm39) missense probably benign
R6319:Adam34 UTSW 8 44,104,952 (GRCm39) missense probably benign 0.01
R6384:Adam34 UTSW 8 44,103,836 (GRCm39) missense probably benign 0.00
R6706:Adam34 UTSW 8 44,104,479 (GRCm39) nonsense probably null
R6992:Adam34 UTSW 8 44,105,642 (GRCm39) start codon destroyed probably null 1.00
R7032:Adam34 UTSW 8 44,105,303 (GRCm39) missense probably damaging 1.00
R7151:Adam34 UTSW 8 44,104,499 (GRCm39) missense probably benign 0.19
R7187:Adam34 UTSW 8 44,105,565 (GRCm39) missense probably benign 0.02
R7223:Adam34 UTSW 8 44,105,041 (GRCm39) missense probably benign 0.02
R7487:Adam34 UTSW 8 44,104,191 (GRCm39) missense probably damaging 1.00
R7789:Adam34 UTSW 8 44,105,488 (GRCm39) missense probably benign 0.00
R7810:Adam34 UTSW 8 44,105,045 (GRCm39) missense probably benign 0.01
R7933:Adam34 UTSW 8 44,103,911 (GRCm39) missense probably damaging 1.00
R8192:Adam34 UTSW 8 44,103,970 (GRCm39) missense probably damaging 1.00
R8231:Adam34 UTSW 8 44,104,659 (GRCm39) missense probably benign
R8238:Adam34 UTSW 8 44,103,993 (GRCm39) missense probably damaging 1.00
R8259:Adam34 UTSW 8 44,104,646 (GRCm39) missense probably benign 0.03
R8339:Adam34 UTSW 8 44,103,640 (GRCm39) missense probably benign 0.20
R8381:Adam34 UTSW 8 44,104,847 (GRCm39) missense possibly damaging 0.70
R8670:Adam34 UTSW 8 44,105,126 (GRCm39) missense possibly damaging 0.91
R8693:Adam34 UTSW 8 44,104,641 (GRCm39) missense probably benign
R8932:Adam34 UTSW 8 44,105,192 (GRCm39) missense probably benign 0.19
R8936:Adam34 UTSW 8 44,104,439 (GRCm39) missense probably benign 0.00
R8981:Adam34 UTSW 8 44,103,840 (GRCm39) missense probably benign 0.05
R9040:Adam34 UTSW 8 44,103,363 (GRCm39) unclassified probably benign
R9105:Adam34 UTSW 8 44,103,785 (GRCm39) missense probably damaging 1.00
R9305:Adam34 UTSW 8 44,104,416 (GRCm39) missense probably damaging 1.00
R9321:Adam34 UTSW 8 44,105,243 (GRCm39) missense probably damaging 1.00
R9641:Adam34 UTSW 8 44,104,076 (GRCm39) missense probably damaging 0.97
R9644:Adam34 UTSW 8 44,104,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGTTTCCAAAGCGGTCACC -3'
(R):5'- CCATGTGTGGCAATAACTTGG -3'

Sequencing Primer
(F):5'- ACCCCGTCTGTTCATTTCCATGTAG -3'
(R):5'- CATGTGTGGCAATAACTTGGTTGAAG -3'
Posted On 2019-11-12