Incidental Mutation 'R7726:Armc6'
ID 595497
Institutional Source Beutler Lab
Gene Symbol Armc6
Ensembl Gene ENSMUSG00000002343
Gene Name armadillo repeat containing 6
Synonyms 2410153K17Rik
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70672822-70687099 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70675248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 326 (D326Y)
Ref Sequence ENSEMBL: ENSMUSP00000019679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019679] [ENSMUST00000130319]
AlphaFold Q8BNU0
Predicted Effect probably damaging
Transcript: ENSMUST00000019679
AA Change: D326Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019679
Gene: ENSMUSG00000002343
AA Change: D326Y

DomainStartEndE-ValueType
Blast:UTG 14 77 2e-26 BLAST
ARM 140 182 8.74e1 SMART
ARM 184 226 3.64e-7 SMART
ARM 237 280 6.01e0 SMART
ARM 281 323 1.13e-3 SMART
ARM 324 366 8.3e-2 SMART
ARM 368 410 1.06e1 SMART
Blast:ARM 438 468 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130319
SMART Domains Protein: ENSMUSP00000116811
Gene: ENSMUSG00000002343

DomainStartEndE-ValueType
Blast:UTG 14 78 8e-30 BLAST
Meta Mutation Damage Score 0.3692 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene's protein product has not been determined. A related protein in mouse suggests that this protein has a conserved function. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Armc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02251:Armc6 APN 8 70,677,870 (GRCm39) nonsense probably null
IGL03090:Armc6 APN 8 70,684,004 (GRCm39) missense probably benign 0.00
R1449:Armc6 UTSW 8 70,677,943 (GRCm39) missense probably benign 0.01
R1557:Armc6 UTSW 8 70,678,098 (GRCm39) missense possibly damaging 0.75
R1689:Armc6 UTSW 8 70,682,187 (GRCm39) missense probably benign
R3054:Armc6 UTSW 8 70,677,799 (GRCm39) missense probably benign 0.12
R4368:Armc6 UTSW 8 70,677,943 (GRCm39) missense probably benign 0.01
R6654:Armc6 UTSW 8 70,684,025 (GRCm39) missense probably damaging 0.99
R8340:Armc6 UTSW 8 70,673,502 (GRCm39) missense probably damaging 1.00
X0022:Armc6 UTSW 8 70,675,192 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGGGAACAGAAACTCCAGTC -3'
(R):5'- GGTCATGATCCTGTTGTCCCAG -3'

Sequencing Primer
(F):5'- GAAACTCCAGTCCTTCACCTAG -3'
(R):5'- GGGTGGTCACATGTGTTCAAAC -3'
Posted On 2019-11-12