Incidental Mutation 'R7726:Pcnx2'
ID595499
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7726 (G1)
Quality Score211.009
Status Not validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125850330 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 988 (V988I)
Ref Sequence ENSEMBL: ENSMUSP00000042294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000131127]
Predicted Effect probably benign
Transcript: ENSMUST00000047239
AA Change: V988I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: V988I

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131127
AA Change: V988I

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119965
Gene: ENSMUSG00000060212
AA Change: V988I

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 968 990 N/A INTRINSIC
transmembrane domain 1010 1029 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 intron probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 intron probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
R7326:Pcnx2 UTSW 8 125887083 missense probably damaging 1.00
R7373:Pcnx2 UTSW 8 125808027 missense probably damaging 1.00
R7397:Pcnx2 UTSW 8 125890885 intron probably null
R7662:Pcnx2 UTSW 8 125818771 nonsense probably null
R7693:Pcnx2 UTSW 8 125887125 missense probably benign 0.09
R7745:Pcnx2 UTSW 8 125851107 missense probably benign 0.04
R7792:Pcnx2 UTSW 8 125892018 missense possibly damaging 0.63
R7797:Pcnx2 UTSW 8 125785348 missense possibly damaging 0.70
RF018:Pcnx2 UTSW 8 125877519 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125761654 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125838014 missense probably benign 0.30
Z1177:Pcnx2 UTSW 8 125887960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCACTGACTTTGAGGACG -3'
(R):5'- AATCTTTCCTATACTAGCAGTGGCC -3'

Sequencing Primer
(F):5'- GCACTGACTTTGAGGACGAATCTC -3'
(R):5'- CTATACTAGCAGTGGCCTGTGTC -3'
Posted On2019-11-12