Mutagenetix > Incidental Mutations

Incidental Mutation 'R7726:Pcnx2'

595499

Institutional Source

Beutler Lab

Gene Symbol

Pcnx2

Ensembl Gene

ENSMUSG00000060212

Gene Name

pecanex homolog 2

Synonyms

Pcnxl2, E330039K12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

211.009

Status

Validated

Chromosome

Chromosomal Location

125751508-125898317 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125850330 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 988 (V988I)

Ref Sequence

ENSEMBL: ENSMUSP00000042294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000131127]

Predicted Effect

probably benign
Transcript: ENSMUST00000047239
AA Change: V988I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: V988I

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	881	902	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	976	998	N/A	INTRINSIC
transmembrane domain	1011	1030	N/A	INTRINSIC
transmembrane domain	1080	1102	N/A	INTRINSIC
transmembrane domain	1104	1126	N/A	INTRINSIC
Pfam:Pecanex_C	1603	1828	3.5e-113	PFAM
low complexity region	1864	1889	N/A	INTRINSIC
low complexity region	1968	1981	N/A	INTRINSIC
low complexity region	2004	2019	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131127
AA Change: V988I

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000119965
Gene: ENSMUSG00000060212
AA Change: V988I

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	968	990	N/A	INTRINSIC
transmembrane domain	1010	1029	N/A	INTRINSIC

Meta Mutation Damage Score

0.0821

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Pcnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcnx2	APN	8	125887585	missense	probably damaging	1.00
IGL00900:Pcnx2	APN	8	125863236	splice site	probably benign
IGL01134:Pcnx2	APN	8	125863150	missense	probably benign
IGL01370:Pcnx2	APN	8	125801483	missense	probably damaging	0.96
IGL01452:Pcnx2	APN	8	125838032	missense	probably damaging	1.00
IGL01477:Pcnx2	APN	8	125785305	missense	probably damaging	1.00
IGL01610:Pcnx2	APN	8	125839633	missense	possibly damaging	0.67
IGL01640:Pcnx2	APN	8	125801558	missense	probably benign	0.14
IGL01645:Pcnx2	APN	8	125887917	missense	probably damaging	1.00
IGL01876:Pcnx2	APN	8	125866031	missense	probably benign	0.31
IGL01933:Pcnx2	APN	8	125761654	missense	probably damaging	1.00
IGL02208:Pcnx2	APN	8	125752155	missense	probably benign	0.30
IGL02573:Pcnx2	APN	8	125855273	missense	probably benign	0.34
IGL02810:Pcnx2	APN	8	125887203	missense	probably benign	0.03
IGL02859:Pcnx2	APN	8	125863173	missense	probably damaging	1.00
IGL02879:Pcnx2	APN	8	125772057	missense	probably damaging	1.00
IGL03202:Pcnx2	APN	8	125772044	missense	probably damaging	0.98
IGL03259:Pcnx2	APN	8	125753649	missense	probably benign	0.19
IGL03395:Pcnx2	APN	8	125887523	missense	probably benign	0.00
IGL03410:Pcnx2	APN	8	125887040	missense	probably damaging	1.00
gallen	UTSW	8	125891120	missense	probably damaging	1.00
hotzone	UTSW	8	125891141	missense	probably benign	0.00
R0107:Pcnx2	UTSW	8	125753586	missense	probably benign	0.29
R0477:Pcnx2	UTSW	8	125761567	missense	probably damaging	0.99
R0610:Pcnx2	UTSW	8	125839687	missense	probably damaging	1.00
R0645:Pcnx2	UTSW	8	125760720	missense	possibly damaging	0.64
R0894:Pcnx2	UTSW	8	125886926	splice site	probably benign
R1083:Pcnx2	UTSW	8	125772104	missense	probably damaging	1.00
R1199:Pcnx2	UTSW	8	125887314	missense	possibly damaging	0.60
R1296:Pcnx2	UTSW	8	125773833	missense	probably damaging	1.00
R1445:Pcnx2	UTSW	8	125752284	missense	probably damaging	0.99
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1524:Pcnx2	UTSW	8	125891141	missense	probably benign	0.00
R1537:Pcnx2	UTSW	8	125877449	missense	possibly damaging	0.94
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1593:Pcnx2	UTSW	8	125759273	missense	probably benign	0.11
R1598:Pcnx2	UTSW	8	125772086	missense	probably benign	0.03
R1603:Pcnx2	UTSW	8	125839626	missense	probably damaging	1.00
R1697:Pcnx2	UTSW	8	125850348	missense	probably damaging	1.00
R1759:Pcnx2	UTSW	8	125773978	missense	probably damaging	1.00
R1855:Pcnx2	UTSW	8	125807996	splice site	probably benign
R1863:Pcnx2	UTSW	8	125818786	missense	probably damaging	0.98
R1930:Pcnx2	UTSW	8	125887714	missense	probably benign	0.10
R1967:Pcnx2	UTSW	8	125815683	missense	possibly damaging	0.51
R1974:Pcnx2	UTSW	8	125887371	missense	probably benign	0.00
R1998:Pcnx2	UTSW	8	125887143	missense	probably damaging	1.00
R2034:Pcnx2	UTSW	8	125818667	critical splice donor site	probably null
R2072:Pcnx2	UTSW	8	125761742	missense	possibly damaging	0.90
R2096:Pcnx2	UTSW	8	125759248	missense	probably benign	0.27
R2216:Pcnx2	UTSW	8	125888077	missense	probably benign	0.00
R2290:Pcnx2	UTSW	8	125877595	splice site	probably benign
R2373:Pcnx2	UTSW	8	125753451	missense	probably damaging	1.00
R2484:Pcnx2	UTSW	8	125891120	missense	probably damaging	1.00
R2849:Pcnx2	UTSW	8	125760927	missense	probably damaging	1.00
R2891:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2892:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2970:Pcnx2	UTSW	8	125801536	missense	probably damaging	1.00
R3013:Pcnx2	UTSW	8	125887770	missense	probably benign	0.05
R3608:Pcnx2	UTSW	8	125888101	missense	probably benign
R3876:Pcnx2	UTSW	8	125888158	missense	probably benign
R4349:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4352:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4353:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4361:Pcnx2	UTSW	8	125768298	nonsense	probably null
R4735:Pcnx2	UTSW	8	125828041	critical splice donor site	probably null
R4749:Pcnx2	UTSW	8	125887588	missense	probably damaging	1.00
R4812:Pcnx2	UTSW	8	125865939	missense	probably benign	0.00
R4819:Pcnx2	UTSW	8	125855230	missense	probably benign	0.04
R4829:Pcnx2	UTSW	8	125861058	splice site	probably null
R4832:Pcnx2	UTSW	8	125752188	missense	probably damaging	0.99
R4876:Pcnx2	UTSW	8	125772108	missense	probably damaging	1.00
R4974:Pcnx2	UTSW	8	125851130	missense	probably benign	0.00
R5057:Pcnx2	UTSW	8	125855191	missense	possibly damaging	0.95
R5078:Pcnx2	UTSW	8	125752156	missense	probably benign
R5114:Pcnx2	UTSW	8	125838010	missense	possibly damaging	0.89
R5195:Pcnx2	UTSW	8	125801549	missense	possibly damaging	0.69
R5239:Pcnx2	UTSW	8	125861082	splice site	probably null
R5348:Pcnx2	UTSW	8	125818756	missense	probably damaging	1.00
R5398:Pcnx2	UTSW	8	125887948	missense	possibly damaging	0.63
R5448:Pcnx2	UTSW	8	125888149	missense	probably benign	0.14
R5534:Pcnx2	UTSW	8	125838015	missense	possibly damaging	0.65
R5624:Pcnx2	UTSW	8	125761523	critical splice donor site	probably null
R5629:Pcnx2	UTSW	8	125898041	missense	probably damaging	1.00
R5630:Pcnx2	UTSW	8	125860958	missense	probably damaging	0.99
R5782:Pcnx2	UTSW	8	125753484	missense	probably damaging	1.00
R5877:Pcnx2	UTSW	8	125753728	missense	probably damaging	0.99
R5879:Pcnx2	UTSW	8	125773946	missense	probably damaging	1.00
R6114:Pcnx2	UTSW	8	125773947	missense	probably damaging	1.00
R6152:Pcnx2	UTSW	8	125753752	missense	probably damaging	0.99
R6154:Pcnx2	UTSW	8	125762813	missense	probably damaging	1.00
R6283:Pcnx2	UTSW	8	125877586	missense	probably damaging	0.99
R6500:Pcnx2	UTSW	8	125753485	missense	probably damaging	1.00
R6629:Pcnx2	UTSW	8	125891112	missense	probably benign	0.00
R6708:Pcnx2	UTSW	8	125860953	critical splice donor site	probably null
R6736:Pcnx2	UTSW	8	125752317	splice site	probably null
R6748:Pcnx2	UTSW	8	125850335	missense	probably damaging	1.00
R6788:Pcnx2	UTSW	8	125772100	missense	probably damaging	1.00
R6849:Pcnx2	UTSW	8	125861210	missense	probably damaging	1.00
R6947:Pcnx2	UTSW	8	125850282	critical splice donor site	probably null
R7034:Pcnx2	UTSW	8	125785302	missense	probably damaging	1.00
R7100:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R7124:Pcnx2	UTSW	8	125753617	missense	probably damaging	0.99
R7130:Pcnx2	UTSW	8	125753584	nonsense	probably null
R7133:Pcnx2	UTSW	8	125801504	missense	probably benign	0.01
R7271:Pcnx2	UTSW	8	125886951	missense	probably benign
R7326:Pcnx2	UTSW	8	125887083	missense	probably damaging	1.00
R7373:Pcnx2	UTSW	8	125808027	missense	probably damaging	1.00
R7397:Pcnx2	UTSW	8	125890885	splice site	probably null
R7662:Pcnx2	UTSW	8	125818771	nonsense	probably null
R7693:Pcnx2	UTSW	8	125887125	missense	probably benign	0.09
R7745:Pcnx2	UTSW	8	125851107	missense	probably benign	0.04
R7792:Pcnx2	UTSW	8	125892018	missense	possibly damaging	0.63
R7797:Pcnx2	UTSW	8	125785348	missense	possibly damaging	0.70
R7921:Pcnx2	UTSW	8	125837863	missense	probably benign
R7984:Pcnx2	UTSW	8	125759126	missense	probably benign
R8098:Pcnx2	UTSW	8	125768301	missense	probably damaging	1.00
R8277:Pcnx2	UTSW	8	125866016	missense	probably damaging	1.00
R8312:Pcnx2	UTSW	8	125762850	missense	possibly damaging	0.69
R8354:Pcnx2	UTSW	8	125761618	missense	probably damaging	0.99
R8378:Pcnx2	UTSW	8	125760910	missense	probably damaging	1.00
R8713:Pcnx2	UTSW	8	125818786	missense	probably damaging	1.00
R8714:Pcnx2	UTSW	8	125773807	missense	probably benign
R8753:Pcnx2	UTSW	8	125887260	missense	probably benign	0.15
R8790:Pcnx2	UTSW	8	125877567	missense	probably benign
RF018:Pcnx2	UTSW	8	125877519	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125826928	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125866018	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125761654	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125838014	missense	probably benign	0.30
Z1177:Pcnx2	UTSW	8	125887960	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCACTGACTTTGAGGACG -3'
(R):5'- AATCTTTCCTATACTAGCAGTGGCC -3'

Sequencing Primer
(F):5'- GCACTGACTTTGAGGACGAATCTC -3'
(R):5'- CTATACTAGCAGTGGCCTGTGTC -3'

Posted On

2019-11-12